si:ch211-66i11.1

Ensembl ID:
ENSDARG00000060093
ZFIN ID:
ZDB-GENE-060526-177
Description:
death-associated protein kinase 1 [Source:RefSeq peptide;Acc:NP_001093460]
Human Orthologue:
DAPK1
Human Description:
death-associated protein kinase 1 [Source:HGNC Symbol;Acc:2674]
Mouse Orthologue:
Dapk1
Mouse Description:
death associated protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1916885]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33687 Nonsense Mutation detected in F1 DNA During 2017
sa33688 Nonsense Mutation detected in F1 DNA During 2017
sa14882 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084314 Nonsense 54 1439 2 25
ENSDART00000124059 Nonsense 54 1439 3 26

The following transcripts of ENSDARG00000060093 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46325381)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44106646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGTATGCAGCCAAATTTATCAAGAAGAGGCGGAGCAAATCAAGCCGA[C/T]GAGGGGTCTCAAAAGACGACATTGAGAGGGAGGTCAGCATCCTGAAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084314 Nonsense 1052 1439 25 25
ENSDART00000124059 Nonsense 1052 1439 26 26

The following transcripts of ENSDARG00000060093 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46411545)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44192810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGCTCTGTAGTAACGTACTTGGCAAGCTTCTCTCAATTGAAACCCCC[A/T]AAGCAATCCACCATTATCGCGGCCGATACCGTGTAGAAGAGCTCCAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084314 Nonsense 1160 1439 25 25
ENSDART00000124059 Nonsense 1160 1439 26 26

The following transcripts of ENSDARG00000060093 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46411869)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44193134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYGGACTTTTCCATAAGTTACAGGTGAACTTGTGCAGGTGGAGCCGCCAG[C/T]AGAAGCCWGAGGTGGAGGCTGATGAWGTGAGGTTGTGGAGCGGTGGCGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link