btaf1

Ensembl ID:
ENSDARG00000060089
ZFIN ID:
ZDB-GENE-021025-1
Description:
TATA-binding protein-associated factor 172 [Source:RefSeq peptide;Acc:NP_001152878]
Human Orthologue:
BTAF1
Human Description:
BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisia
Mouse Orthologue:
Btaf1
Mouse Description:
BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, (Mot1 homolog, S. cerevisiae) Gene

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42286 Nonsense Mutation detected in F1 DNA During 2016
sa22371 Essential Splice Site Available for shipment Available now
sa42285 Nonsense Mutation detected in F1 DNA During 2016
sa22370 Essential Splice Site Available for shipment Available now
sa12382 Nonsense Available for shipment Available now
sa9449 Nonsense Available for shipment Available now
sa8540 Nonsense Available for shipment Available now
sa31958 Essential Splice Site Available for shipment Available now
sa10826 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084327 Nonsense 28 1861 2 38
ENSDART00000134533 Nonsense 25 1858 2 38

The following transcripts of ENSDARG00000060089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 43183568)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42404527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTATTGGATACAGGAACGACTCCTGTCACCCGTAAAGCTGCTGCTCAG[C/T]AGTTGGGAGATGTTGTTAAGCTTCACCCACATGAGCTTAATAACCTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084327 Essential Splice Site 85 1861 3 38
ENSDART00000134533 Essential Splice Site 82 1858 3 38

The following transcripts of ENSDARG00000060089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 43181370)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42402329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGTGAAGAATATTCCAGAATGGAACCCATCTCCAAAGCCAAAAGATGG[T/G]GAGCGAAAATTCCCAGCCTGCATTTCTGGAAAATTGGAGATTGTGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084327 Nonsense 369 1861 10 38
ENSDART00000134533 Nonsense 366 1858 10 38

The following transcripts of ENSDARG00000060089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 43172382)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42393341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCAGACTCTTGTGCGTCTTTGCTTTAGACAGATTTGGAGATTTTGTAT[C/A]GGATGAGGTTTGTCCATTTCTAATATTTGAATCCCTCTGTCAATGTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22370
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084327 Essential Splice Site 430 1861 11 38
ENSDART00000134533 Essential Splice Site 427 1858 11 38

The following transcripts of ENSDARG00000060089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 43170081)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42391040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGACACGGCGGTCTGTTGGGCATCAAATATGCTCTGGCTGTCAGACAG[G/A]TGGAGCAGTCTCAATTTTATTGGCTGTAATTTGAAAGTTATACTTGCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084327 Nonsense 1293 1861 27 38
ENSDART00000134533 Nonsense 1290 1858 27 38

The following transcripts of ENSDARG00000060089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 43144414)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42365373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGTTTTTTNGCAGGATGGTGTGAACTGGCTGGCRTTTTTGAACAAGTA[C/A]AAGCTCCATGGGATTTTGTGTGATGAYATGGGTCTGGGTAAAACCCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084327 Nonsense 1376 1861 28 38
ENSDART00000134533 Nonsense 1373 1858 28 38
ENSDART00000084327 Nonsense 1376 1861 28 38
ENSDART00000134533 Nonsense 1373 1858 28 38

The following transcripts of ENSDARG00000060089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 43144088)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42365047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTAAAGAGTTTCTTAATCCTCTGCATTATACTGGCCCTCCCACTGAA[C/T]GAGCACGGTATGATCTGAAGAAATGATTTTTTTAAAGNGTGCATTCATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084327 Nonsense 1376 1861 28 38
ENSDART00000134533 Nonsense 1373 1858 28 38
ENSDART00000084327 Nonsense 1376 1861 28 38
ENSDART00000134533 Nonsense 1373 1858 28 38

The following transcripts of ENSDARG00000060089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 43144088)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42365047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTAAAGAGTTTCTTAATCCTCTGCATTATACTGGCCCTCCCACTGAA[C/T]GAGCACGGTATGATCTGAAGAAATGATTTTTTTAAAGNGTGCATTCATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084327 Essential Splice Site 1812 1861 37 38
ENSDART00000134533 Essential Splice Site 1809 1858 37 38

The following transcripts of ENSDARG00000060089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 43135916)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42356875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGAGCATGGGCACAGAGCAACTGCTCAACCTCTTCACACTGGACAAG[G/A]TCAGTCTCTCCTGTCTGTGGCTACAACTCTTTCAAACCTCCATACTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084327 Essential Splice Site 1812 1861 37 38
ENSDART00000134533 Essential Splice Site 1809 1858 37 38

The following transcripts of ENSDARG00000060089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 43135915)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42356874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAGCATGGGCACAGAGCAACTGCTCAACCTCTTYACACTGGACAAGG[T/C]CAGTCTCTCCTGTCTGTGGCTACAACTCTTTCAAACCTCCATACTAAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link