kcnq3

Ensembl ID:
ENSDARG00000060085
ZFIN ID:
ZDB-GENE-070912-301
Description:
Si:ch211-66b9.3 protein [Source:UniProtKB/TrEMBL;Acc:A7MBT2]
Human Orthologue:
KCNQ3
Human Description:
potassium voltage-gated channel, KQT-like subfamily, member 3 [Source:HGNC Symbol;Acc:6297]
Mouse Orthologue:
Kcnq3
Mouse Description:
potassium voltage-gated channel, subfamily Q, member 3 Gene [Source:MGI Symbol;Acc:MGI:1336181]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa531 Nonsense F2 line generated During 2017
sa33002 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa531
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084303 Nonsense 169 401 4 11
ENSDART00000136141   None 395 None 6
ENSDART00000145494 Nonsense 169 391 4 9
Genomic Location (Zv9):
Chromosome 2 (position 43132780)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43182244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTGCTGTCGATATAAAGGCTGGAGAGGACGGCTCAAATTCGCCCGC[A/T]AACCGCTGTGTGTCCTGGGTGAGTTCAACACACCGACCCAAACAAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084303 Nonsense 238 401 6 11
ENSDART00000136141   None 395 None 6
ENSDART00000145494 Nonsense 238 391 6 9
Genomic Location (Zv9):
Chromosome 2 (position 43128693)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43178157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGACAAACTCAACTGTGTGCGTTTTTTAGGAGCTGATCACAGCGTG[G/A]TACATCGGCTTCCTGTCATTGATCCTGGCTTCTTTCCTGGTGTATCTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link