kcnq3

Ensembl ID:
ENSDARG00000060085
ZFIN ID:
ZDB-GENE-070912-301
Description:
Si:ch211-66b9.3 protein [Source:UniProtKB/TrEMBL;Acc:A7MBT2]
Human Orthologue:
KCNQ3
Human Description:
potassium voltage-gated channel, KQT-like subfamily, member 3 [Source:HGNC Symbol;Acc:6297]
Mouse Orthologue:
Kcnq3
Mouse Description:
potassium voltage-gated channel, subfamily Q, member 3 Gene [Source:MGI Symbol;Acc:MGI:1336181]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa531 Nonsense F2 line generated During 2018
sa33002 Nonsense Mutation detected in F1 DNA During 2018
sa44545 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa531
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084303 Nonsense 169 401 4 11
ENSDART00000136141   None 395 None 6
ENSDART00000145494 Nonsense 169 391 4 9
Genomic Location (Zv9):
Chromosome 2 (position 43132780)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43182244
GRCz11 2 43031662
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTGCTGTCGATATAAAGGCTGGAGAGGACGGCTCAAATTCGCCCGC[A/T]AACCGCTGTGTGTCCTGGGTGAGTTCAACACACCGACCCAAACAAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084303 Nonsense 238 401 6 11
ENSDART00000136141   None 395 None 6
ENSDART00000145494 Nonsense 238 391 6 9
Genomic Location (Zv9):
Chromosome 2 (position 43128693)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43178157
GRCz11 2 43027575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGACAAACTCAACTGTGTGCGTTTTTTAGGAGCTGATCACAGCGTG[G/A]TACATCGGCTTCCTGTCATTGATCCTGGCTTCTTTCCTGGTGTATCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084303 Nonsense 288 401 6 11
ENSDART00000136141   None 395 None 6
ENSDART00000145494 Nonsense 288 391 6 9
Genomic Location (Zv9):
Chromosome 2 (position 43128543)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43178007
GRCz11 2 43027425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCGACACCGGCCCCGCAGGACTTTGACACCTATGCAGACGCCCTCTG[G/A]TGGGGACTGGTGAGAATCACACACAGCACTCTTAGGCATTCAGAATATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link