crb2l

Ensembl ID:
ENSDARG00000060081
ZFIN ID:
ZDB-GENE-060610-1
Description:
crumbs homolog 2, like [Source:RefSeq peptide;Acc:NP_001038627]
Human Orthologue:
CRB2
Human Description:
crumbs homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:18688]
Mouse Orthologue:
Crb2
Mouse Description:
crumbs homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2679260]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18042 Nonsense Available for shipment Available now
sa21177 Nonsense Mutation detected in F1 DNA During 2014
sa21178 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084305 Nonsense 10 1458 1 14
Genomic Location:
Chromosome 8 (position 2992133)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCGAGAATCACCGCAGGACATGGATTTTGGACGGATGTGTTTACAGTA[T/G]AAAAGAGCRGTTCTGCTGTCATTGATGTTCAAGCTGGGTAGRACATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084305 Nonsense 935 1458 9 14
Genomic Location:
Chromosome 8 (position 3061810)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGACGACACACAACTGTTCATGTACTCCGGCAGCATCAGCCAGAAGCCA[C/T]AACACGCTAATTACTTACCCAGAAACTCATCCAATGTGCTGGAGGGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084305 Nonsense 1132 1458 11 14
Genomic Location:
Chromosome 8 (position 3065539)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCACATGTCAATTGATGGAAATCCTGCAGGATTCAGTCTCTCTCCTGCT[G/T]GAAATGTAGACTTTTTTAACTCCTCCACTGTGATGCTGGCAGAAAACTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mvd8fjuz