crb2l

Ensembl ID:
ENSDARG00000060081
ZFIN ID:
ZDB-GENE-060610-1
Description:
crumbs homolog 2, like [Source:RefSeq peptide;Acc:NP_001038627]
Human Orthologue:
CRB2
Human Description:
crumbs homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:18688]
Mouse Orthologue:
Crb2
Mouse Description:
crumbs homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2679260]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18042 Nonsense Available for shipment Available now
sa41102 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21177 Nonsense Available for shipment Available now
sa21178 Nonsense Available for shipment Available now
sa41103 Nonsense Mutation detected in F1 DNA During 2016
sa30898 Nonsense Mutation detected in F1 DNA During 2016
sa41104 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084305 Nonsense 10 1458 1 14
Genomic Location (Zv9):
Chromosome 8 (position 2992133)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2768128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCGAGAATCACCGCAGGACATGGATTTTGGACGGATGTGTTTACAGTA[T/G]AAAAGAGCRGTTCTGCTGTCATTGATGTTCAAGCTGGGTAGRACATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084305 Essential Splice Site 465 1458 7 14
Genomic Location (Zv9):
Chromosome 8 (position 3038377)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2813140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGATCTCGTCAATGCTTTTCAATGCTCATGTCCCCCAGGGTTCGCAG[G/T]TATGTAAATATACTCTGTATATTGGAAGTTTAAAGAGGGGCTAATAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084305 Nonsense 935 1458 9 14
Genomic Location (Zv9):
Chromosome 8 (position 3061810)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2836573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGACGACACACAACTGTTCATGTACTCCGGCAGCATCAGCCAGAAGCCA[C/T]AACACGCTAATTACTTACCCAGAAACTCATCCAATGTGCTGGAGGGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084305 Nonsense 1132 1458 11 14
Genomic Location (Zv9):
Chromosome 8 (position 3065539)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2840302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCACATGTCAATTGATGGAAATCCTGCAGGATTCAGTCTCTCTCCTGCT[G/T]GAAATGTAGACTTTTTTAACTCCTCCACTGTGATGCTGGCAGAAAACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084305 Nonsense 1174 1458 11 14
ENSDART00000084305 Nonsense 1174 1458 11 14
Genomic Location (Zv9):
Chromosome 8 (position 3065665)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2840428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGTGGAGTTCACCTATCATTTTTCGGACCTCTAAATGAAGAGGCGCCA[C/T]AAAAAACTCAATTCATCCGAATCGGTGGGATGCTGGAGCCTCATTTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084305 Nonsense 1174 1458 11 14
ENSDART00000084305 Nonsense 1174 1458 11 14
Genomic Location (Zv9):
Chromosome 8 (position 3065665)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2840428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGTGGAGTTCACCTATCATTTTTCGGACCTCTAAATGAAGAGGCGCCA[C/T]AAAAAACTCAATTCATCCGAATCGGTGGGATGCTGGAGCCTCATTTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084305 Nonsense 1305 1458 12 14
Genomic Location (Zv9):
Chromosome 8 (position 3068041)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2842804
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACACAACTCCCATGATTCCACACTCATCCACTGTCCTCCGTCAGATG[G/A]CGGTTTCCTCCTCGTGAGTGTGATGTGGATCTGCAGTGTGAGAATGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link