arid1ab

Ensembl ID:
ENSDARG00000060073
ZFIN ID:
ZDB-GENE-030131-5725
Description:
Novel protein similar to vertebrate AT rich interactive domain containing protein family [Source:Uni
Human Orthologue:
ARID1A
Human Description:
AT rich interactive domain 1A (SWI-like) [Source:HGNC Symbol;Acc:11110]
Mouse Orthologue:
Arid1a
Mouse Description:
AT rich interactive domain 1A (SWI-like) Gene [Source:MGI Symbol;Acc:MGI:1935147]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa325 Nonsense F2 line generated During 2014
sa13632 Essential Splice Site Available for shipment Available now
sa9694 Nonsense Available for shipment Available now
sa13031 Nonsense Available for shipment Available now
sa11863 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa325
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084272 Nonsense 340 2135 2 20
ENSDART00000140747 Nonsense 340 2101 2 20

The following transcripts of ENSDARG00000060073 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 30836693)
KASP Assay ID:
554-3340.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGCAGGGGCCTCCCCCTAGCTCACAGCAGGGTCCTCCTTACCCAGGG[C/T]AGGGTTATGGACCTCCGGGACCTCAGAGGTATCCCATGGGCATGCAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13632
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084272 Essential Splice Site 711 2135 6 20
ENSDART00000140747 Essential Splice Site 711 2101 6 20

The following transcripts of ENSDARG00000060073 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 30865835)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTCCAGTCRGATGGTATGTTACATTCCTCCATGGGYCAGRATAGAGG[T/G]GAGTTTAGATYCATTTTCAGTAATGTTTTGTTATTTTTACAGTTTGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9694
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084272 Nonsense 748 2135 7 20
ENSDART00000140747 Nonsense 748 2101 7 20

The following transcripts of ENSDARG00000060073 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 30867323)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGGCAAACATCTGGAAGCCAAATGCATGCTGGGATGGGTTCCTACCCA[C/T]AGAACAACTCCATGGGCAACTATGGGCCGCAGAGTGGCCAGTATGGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13031
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084272 Nonsense 762 2135 7 20
ENSDART00000140747 Nonsense 762 2101 7 20

The following transcripts of ENSDARG00000060073 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 30867367)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCCAYAGAACAACTCCATGGGCAACTATGGGCCGCAGAGTGGCCAGTA[T/A]GGACCACAAGGTRAGAAGCTTGGGTTAGGCCGAAATAAATAGCTTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11863
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084272 Nonsense 1045 2135 12 20
ENSDART00000140747 Nonsense 1045 2101 12 20

The following transcripts of ENSDARG00000060073 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 30874861)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACWAATCTGAATGTGGGCACATCCAGTAGTGCGGCCAGCTCWCTGAAG[A/T]AACAGYACATCCAGTGTCTCTATGCCTTTGAGTGCAAGATCGAGCGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ushhyue7