A2RUY9_DANRE

Ensembl ID:
ENSDARG00000060071
Description:
LOC568678 protein [Source:UniProtKB/TrEMBL;Acc:A2RUY9]
Human Orthologue:
PAPD5
Human Description:
PAP associated domain containing 5 [Source:HGNC Symbol;Acc:30758]
Mouse Orthologue:
Papd5
Mouse Description:
PAP associated domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1917820]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21016 Nonsense Mutation detected in F1 DNA During 2014
sa21015 Nonsense Mutation detected in F1 DNA During 2014
sa12807 Nonsense Available for shipment Available now
sa21014 Nonsense Mutation detected in F1 DNA During 2014
sa5432 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Nonsense 176 653 2 12
Genomic Location:
Chromosome 7 (position 39268897)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTCTCTCTCACTCTCTCCAGGCTGCATGAAGAGATAAAGGACTTTTA[T/A]GAGTACATATCTCCTCGTCCAGAGGAGGAGCAAATGAGGCATGAGGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Nonsense 220 653 3 12
Genomic Location:
Chromosome 7 (position 39264698)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTCTGATGGCAGGTTTGTGTGTTTGGGAGCTTCAGCACTGGCTTGTA[T/A]TTGCCAACAAGGTAATGCTATGATTTTTGTACTTTGTTTTTACCCACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12807
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Nonsense 302 653 6 12
Genomic Location:
Chromosome 7 (position 39261586)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAAGWAGGTTTTTAATTTCTTMTTWCTTKTGTTTTTTGTTTAGCAATA[T/A]CCKGTGTTACCSTAMCTGGTGCTGGTTTTAAAGCAGTTTTTACTGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21014
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Nonsense 316 653 6 12
Genomic Location:
Chromosome 7 (position 39261545)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGCAATATCCTGTGTTACCGTACCTGGTGCTGGTTTTAAAGCAGTTTT[T/A]ACTGCAGAGAGAGCTGAATGAGGTTTTCACAGGAGGAATCGGATCATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Essential Splice Site 493 653 9 12
Genomic Location:
Chromosome 7 (position 39257746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCRCAGYGGGGTCAGAAGAGCAGCAAGGAGCCCGTTCTCAACTGYAATG[G/A]TGTGACATCCTCCATCAGCTCTTTAAATCTGTCTCTCKCTCTAGAAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hyxr0hoq