A2RUY9_DANRE

Ensembl ID:
ENSDARG00000060071
Description:
LOC568678 protein [Source:UniProtKB/TrEMBL;Acc:A2RUY9]
Human Orthologue:
PAPD5
Human Description:
PAP associated domain containing 5 [Source:HGNC Symbol;Acc:30758]
Mouse Orthologue:
Papd5
Mouse Description:
PAP associated domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1917820]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21016 Nonsense Available for shipment Available now
sa40953 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21015 Nonsense Mutation detected in F1 DNA During 2016
sa31582 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12807 Nonsense Available for shipment Available now
sa21014 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21016
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Nonsense 176 653 2 12
Genomic Location (Zv9):
Chromosome 7 (position 39268897)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37605537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTCTCTCTCACTCTCTCCAGGCTGCATGAAGAGATAAAGGACTTTTA[T/A]GAGTACATATCTCCTCGTCCAGAGGAGGAGCAAATGAGGCATGAGGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Essential Splice Site 208 653 2 12
Genomic Location (Zv9):
Chromosome 7 (position 39268800)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37605440
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGGCCAGGATCCAGAGAGTCATCAAGGACTTGTGGCCCAATGCTGAG[G/A]TTGGTTTTACTCCTCCATGCTTAGTTTCTGTTGATGATTATGTGATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Nonsense 220 653 3 12
Genomic Location (Zv9):
Chromosome 7 (position 39264698)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37601338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTCTGATGGCAGGTTTGTGTGTTTGGGAGCTTCAGCACTGGCTTGTA[T/A]TTGCCAACAAGGTAATGCTATGATTTTTGTACTTTGTTTTTACCCACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Essential Splice Site 224 653 3 12
Genomic Location (Zv9):
Chromosome 7 (position 39264685)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37601325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTTGTGTGTTTGGGAGCTTCAGCACTGGCTTGTATTTGCCAACAAGG[T/C]AATGCTATGATTTTTGTACTTTGTTTTTACCCACTAAGTAATCTGAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12807
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Nonsense 302 653 6 12
Genomic Location (Zv9):
Chromosome 7 (position 39261586)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37598226
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAAGWAGGTTTTTAATTTCTTMTTWCTTKTGTTTTTTGTTTAGCAATA[T/A]CCKGTGTTACCSTAMCTGGTGCTGGTTTTAAAGCAGTTTTTACTGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Nonsense 316 653 6 12
Genomic Location (Zv9):
Chromosome 7 (position 39261545)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37598185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGCAATATCCTGTGTTACCGTACCTGGTGCTGGTTTTAAAGCAGTTTT[T/A]ACTGCAGAGAGAGCTGAATGAGGTTTTCACAGGAGGAATCGGATCATACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link