adcy7

Ensembl ID:
ENSDARG00000060070
ZFIN IDs:
ZDB-GENE-040713-1, ZDB-GENE-040713-1
Description:
adenylate cyclase type 7 [Source:RefSeq peptide;Acc:NP_001159744]
Human Orthologue:
ADCY7
Human Description:
adenylate cyclase 7 [Source:HGNC Symbol;Acc:238]
Mouse Orthologue:
Adcy7
Mouse Description:
adenylate cyclase 7 Gene [Source:MGI Symbol;Acc:MGI:102891]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21013 Nonsense Mutation detected in F1 DNA During 2014
sa1489 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084266 Nonsense 257 1043 5 24
ENSDART00000129156 Nonsense 257 1083 5 25
Genomic Location:
Chromosome 7 (position 39188435)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCATGAAGATGAAGTTGGCCATTATGGAGCGCTGCAAGTGCAAAGAT[A/T]AAGAAGAACAGCAGCGGATGGTCCGGGACAACAACTTCCACAGTCTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084266 Essential Splice Site 916 1043 22 24
ENSDART00000129156 Essential Splice Site 956 1083 23 25
Genomic Location:
Chromosome 7 (position 39166426)
KASP Assay ID:
554-1414.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATCTGTGGTGTAGTTTGTGCTTGACCGKCTCTGTTGTGTTTGCCTCC[A/G]GGACCGTGAGCGGCAGAATGCACAGATAGGAAACATGGTGGAGTTCGCCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vss877ek