isoc1

Ensembl ID:
ENSDARG00000060069
ZFIN ID:
ZDB-GENE-061020-1
Description:
Isochorismatase domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q08C33]
Human Orthologue:
ISOC1
Human Description:
isochorismatase domain containing 1 [Source:HGNC Symbol;Acc:24254]
Mouse Orthologue:
Isoc1
Mouse Description:
isochorismatase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913557]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21698 Essential Splice Site Available for shipment Available now
sa21699 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21698
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084278 Essential Splice Site 128 283 2 5
ENSDART00000123875 Essential Splice Site 128 355 2 6
Genomic Location (Zv9):
Chromosome 10 (position 16500991)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16592148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGCAATCAAATACTTTGGTGACATCATCAGTGTTGGCCAGAGGCTGG[T/C]AAATTTTCTGATTCTTCAAATGAAAGCATGATTCTTTAAGTCAGGTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21699
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084278 Essential Splice Site 129 283 3 5
ENSDART00000123875 Essential Splice Site 129 355 3 6
Genomic Location (Zv9):
Chromosome 10 (position 16507986)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16599143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAATAATTGGATTCATTTTAATTATCATTTTGTGTTTGTGTTGGCACA[G/A]CTTCAGGGGGCTCGTATTCTGGGTATTCCTGTGGTGGTGTCTGAGCAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link