fam98b

Ensembl ID:
ENSDARG00000060068
ZFIN ID:
ZDB-GENE-061201-63
Description:
hypothetical protein LOC780841 [Source:RefSeq peptide;Acc:NP_001073130]
Human Orthologue:
FAM98B
Human Description:
family with sequence similarity 98, member B [Source:HGNC Symbol;Acc:26773]
Mouse Orthologue:
Fam98b
Mouse Description:
family with sequence similarity 98, member B Gene [Source:MGI Symbol;Acc:MGI:1915465]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36547 Nonsense Mutation detected in F1 DNA During 2016
sa32177 Nonsense Available for shipment Available now
sa13030 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084268 Nonsense 40 358 2 8
Genomic Location (Zv9):
Chromosome 17 (position 53164478)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52550045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCTGGCCGAGTGTGGGCGGGGCTTCAGCTCATCTGAATATGTTAATT[T/A]GCTGACGTGGCTCACAAAACAACTGACACAATTCACTGAGACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084268 Nonsense 204 358 6 8
Genomic Location (Zv9):
Chromosome 17 (position 53162486)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52548053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTCAGGAGGAGCTGGAGAAGATCAACAGCACTCTGTCGGCGGAGTA[C/A]GAGTGCCGGCGGCGGATGCTCATCAAACGCCTCGACGTCACTGTGCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13030
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084268 Nonsense 325 358 8 8
Genomic Location (Zv9):
Chromosome 17 (position 53160459)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52546026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCACCTGGAGGAAGAGATCTGATGGAGGAGRAGGACRAGGGGCGGGATA[T/G]AGAGGAGGAGGAGGNNNNANNNTGGCAGACKGGTGGAGGAGAYGGCTGGAGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link