C14orf166B

Ensembl ID:
ENSDARG00000060062
Description:
chromosome 14 open reading frame 166B [Source:HGNC Symbol;Acc:23346]
Human Orthologue:
C14orf166B
Human Description:
chromosome 14 open reading frame 166B [Source:HGNC Symbol;Acc:23346]
Mouse Orthologue:
Gm6772
Mouse Description:
predicted gene 6772 Gene [Source:MGI Symbol;Acc:MGI:3646959]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36546 Nonsense Mutation detected in F1 DNA During 2016
sa39181 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15338 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084252 Nonsense 3 405 1 12
ENSDART00000103572 Nonsense 6 413 1 11
Genomic Location (Zv9):
Chromosome 17 (position 53137845)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52523412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGTATCAGGGGTGAAGCTGATCAGGAAGGATTTGTCGACTGAAGAAT[T/A]GTACCTGCAGGCCTGTAAACTGGTGGGAGTCATTCCTGTCAGATACTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084252 Essential Splice Site 48 405 1 12
ENSDART00000103572 Essential Splice Site 51 413 1 11
Genomic Location (Zv9):
Chromosome 17 (position 53137708)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52523275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACGGCCTCGGTCCACTGGGAGGAAAAGCCCTGGCCATCGCTCTAGTG[G/A]TGAGACTCATGCAGCACCATCTACAGGCTATACTATACTATACTATACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084252 Essential Splice Site 133 405 5 12
ENSDART00000103572 Essential Splice Site 136 413 5 11
Genomic Location (Zv9):
Chromosome 17 (position 53133705)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52519272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YAAACATCKCTCWGATTTTCAAGAGATGAAGGAYCTGATTTTGTTTCTTC[A/T]GAGCAACTACAGGGTGAAGGAGCTGGATTTAAGCCACAACGAGTTCAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link