C14orf166B

Ensembl ID:
ENSDARG00000060062
Description:
chromosome 14 open reading frame 166B [Source:HGNC Symbol;Acc:23346]
Human Orthologue:
C14orf166B
Human Description:
chromosome 14 open reading frame 166B [Source:HGNC Symbol;Acc:23346]
Mouse Orthologue:
Gm6772
Mouse Description:
predicted gene 6772 Gene [Source:MGI Symbol;Acc:MGI:3646959]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15338 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084252 Essential Splice Site 133 405 5 12
ENSDART00000103572 Essential Splice Site 136 413 5 11
Genomic Location:
Chromosome 17 (position 53133705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YAAACATCKCTCWGATTTTCAAGAGATGAAGGAYCTGATTTTGTTTCTTC[A/T]GAGCAACTACAGGGTGAAGGAGCTGGATTTAAGCCACAACGAGTTCAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z8yb9w2p