LOC100150282

Ensembl ID:
ENSDARG00000060053
Human Orthologue:
KCNH2
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 2 [Source:HGNC Symbol;Acc:6251]
Mouse Orthologue:
Kcnh2
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 2 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4265 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084238 Nonsense 345 680 5 7
Genomic Location:
Chromosome 24 (position 42050470)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTCCTCCTGCAGGTTCTGTCTCTGGGCGCYGACGTTCTGCCGGAGTA[T/G]AAGCTGCAGGCTCCGCGGATCCAYAAGTGGACGGTTCTACACTACAGCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5xvw15nu