rnf32

Ensembl ID:
ENSDARG00000060035
ZFIN ID:
ZDB-GENE-061013-39
Description:
RING finger protein 32 [Source:RefSeq peptide;Acc:NP_001070724]
Human Orthologue:
RNF32
Human Description:
ring finger protein 32 [Source:HGNC Symbol;Acc:17118]
Mouse Orthologue:
Rnf32
Mouse Description:
ring finger protein 32 Gene [Source:MGI Symbol;Acc:MGI:1861747]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14423 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084179 Nonsense 173 363 5 8
ENSDART00000135755 None None 37 None 3
Genomic Location:
Chromosome 7 (position 42123297)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGTTGCCCAATGTGCAGAAAAGAGCAGTACGAGACWAGGGTGATCTA[T/A]GATGGTGCTAGGYTCTATCGGGAAAAGTGTGCTCTCAGGTAAAGAAATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g0zxa5f3