setd1a

Ensembl ID:
ENSDARG00000060030
ZFIN ID:
ZDB-GENE-080521-4
Description:
KIAA0339 protein [Source:UniProtKB/TrEMBL;Acc:Q071D7]
Human Orthologue:
SETD1A
Human Description:
SET domain containing 1A [Source:HGNC Symbol;Acc:29010]
Mouse Orthologue:
Setd1a
Mouse Description:
SET domain containing 1A Gene [Source:MGI Symbol;Acc:MGI:2446244]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11613 Nonsense Available for shipment Available now
sa44565 Nonsense Mutation detected in F1 DNA During 2017
sa14532 Nonsense Available for shipment Available now
sa20054 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa11613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083821   None 406 None 7
ENSDART00000125022   683 1916 16 38
ENSDART00000131774   None 322 None 7
ENSDART00000137062 Nonsense 64 180 2 2
ENSDART00000142133   None 310 None 8
ENSDART00000147403   None 255 None 2
Genomic Location (Zv9):
Chromosome 3 (position 32859955)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32591265
KASP Assay ID:
2259-3686.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTTCATCCTCTTCACCAGCAGCTTCCTCACAGACTGTCCTCYCATCC[C/T]AAACCACAGACCCCTCTGCAAGCCCTGCCCCTGACACCAGCCAGCACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083821   None 406 None 7
ENSDART00000125022 Nonsense 920 1916 20 38
ENSDART00000131774   None 322 None 7
ENSDART00000137062   None 179 None 2
ENSDART00000142133 Nonsense 84 310 2 8
ENSDART00000147403   None 255 None 2
Genomic Location (Zv9):
Chromosome 3 (position 32861031)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACGACAAGCAATCGACCTAGAGAGCCACTCATGTCTCTGGTAGACTG[G/A]GCTAAGAGTGGAGGCATGGAGGGTTTCTCCCTGCGGGGGGCATTGCGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14532
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083821   None 406 None 7
ENSDART00000125022 Nonsense 1518 1916 30 38
ENSDART00000131774   None 322 None 7
ENSDART00000137062   None 180 None 2
ENSDART00000142133   None 310 None 8
ENSDART00000147403   None 255 None 2
Genomic Location (Zv9):
Chromosome 3 (position 32866777)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32598087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACCACTMCTGGATCCAGAGGGTCTATTYGTCATGCAGGAGCACAACTA[T/G]TCTAAAACTCCTGCACCTCAACACAWTACGCCTCCACAGAAGARGACGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083821   None 406 None 7
ENSDART00000125022 Missense 1583 1916 31 38
ENSDART00000131774   None 322 None 7
ENSDART00000137062   None 180 None 2
ENSDART00000142133   None 310 None 8
ENSDART00000147403   None 255 None 2
Genomic Location (Zv9):
Chromosome 3 (position 32867049)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32598359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTAGCTCACCATACAAGAGGACCGGCTCGATCAGCAAAGAGGTGGATT[T/A]GGAGGAGAGGGGGAAAGGTAAAAACAAGAAGAGAAGTAGGAAGGACAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link