nom1

Ensembl ID:
ENSDARG00000060027
ZFIN ID:
ZDB-GENE-060503-321
Description:
nucleolar MIF4G domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001038297]
Human Orthologue:
NOM1
Human Description:
nucleolar protein with MIF4G domain 1 [Source:HGNC Symbol;Acc:13244]
Mouse Orthologue:
Nom1
Mouse Description:
nucleolar protein with MIF4G domain 1 Gene [Source:MGI Symbol;Acc:MGI:1861749]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8417 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31587 Nonsense Available for shipment Available now
sa40973 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084153 Essential Splice Site None 487 None 12
ENSDART00000115152 Essential Splice Site 343 835 None 12
ENSDART00000142315 Essential Splice Site 106 598 None 12
Genomic Location (Zv9):
Chromosome 7 (position 42045958)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40382268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTGAGCTGGAGAAGCTGAAGCGCAGTGTGAAAGGTCTGATTAACAGG[T/C]AAGGTGTCACAGAGATNNTAACTTGATTAATGCATTTTAAAGAGGCTTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084153 Nonsense 311 487 9 12
ENSDART00000115152 Nonsense 659 835 9 12
ENSDART00000142315 Nonsense 422 598 9 12
Genomic Location (Zv9):
Chromosome 7 (position 42041546)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40377856
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGACAGTGGATTCTTAATTCTTTCTCAGGTTAGGATTGAAAGACCAG[C/T]AAGAGCGGGAGATTGTTCATGTTTTGATGGACTGCTGCCTGCAGGAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084153 Nonsense 325 487 9 12
ENSDART00000115152 Nonsense 673 835 9 12
ENSDART00000142315 Nonsense 436 598 9 12
Genomic Location (Zv9):
Chromosome 7 (position 42041504)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40377814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACCAGCAAGAGCGGGAGATTGTTCATGTTTTGATGGACTGCTGCCTG[C/T]AGGAGAAGATGTTTAATAGATTTTATGCTGTTCTGGCTGAGAAGCTTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link