ccbe1

Ensembl ID:
ENSDARG00000060022
ZFIN ID:
ZDB-GENE-090506-7
Description:
Collagen and calcium-binding EGF domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A8WGB1
Human Orthologue:
CCBE1
Human Description:
collagen and calcium binding EGF domains 1 [Source:HGNC Symbol;Acc:29426]
Mouse Orthologue:
Ccbe1
Mouse Description:
collagen and calcium binding EGF domains 1 Gene [Source:MGI Symbol;Acc:MGI:2445053]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1019 Nonsense Available for shipment Available now
sa17588 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084116 Nonsense 28 208 1 6
Genomic Location:
Chromosome 17 (position 2098260)
KASP Assay ID:
554-0923.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGGCCGTGGCGCTCGTACTGYTCTCATCGGGAGCTCCKTGGACTTTC[C/T]GAGAGGAGAAGGAGGATGTAGACAGGTAAAGTGCTGTGCTGTCTGTCTGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa17588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084116 Nonsense 49 208 2 6
Genomic Location:
Chromosome 17 (position 2098455)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCTTGCAGAGAAGTGTGTTCAGAAAGCAAAATCGCAACGACGAAGTA[C/G]CCKTGCGTAAAGTCCACTGGAGAGGTGACCACATGCTACAGGTAAACGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8f6ggk63