nsd1a

Ensembl ID:
ENSDARG00000060016
ZFIN ID:
ZDB-GENE-080519-3
Description:
Nuclear receptor binding SET domain protein 1a [Source:UniProtKB/TrEMBL;Acc:A5XBQ0]
Human Orthologues:
EZH1, EZH2, SETD2, WHSC1, WHSC1L1
Human Descriptions:
enhancer of zeste homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:3526]
enhancer of zeste homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:3527]
SET domain containing 2 [Source:HGNC Symbol;Acc:18420]
Wolf-Hirschhorn syndrome candidate 1 [Source:HGNC Symbol;Acc:12766]
Wolf-Hirschhorn syndrome candidate 1-like 1 [Source:HGNC Symbol;Acc:12767]
Mouse Orthologues:
Ezh1, Ezh2, Setd2, Whsc1, Whsc1l1
Mouse Descriptions:
enhancer of zeste homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1097695]
enhancer of zeste homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:107940]
SET domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918177]
Wolf-Hirschhorn syndrome candidate 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1276574]
Wolf-Hirschhorn syndrome candidate 1-like 1 (human) Gene [Source:MGI Symbol;Acc:MGI:2142581]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13619 Essential Splice Site Available for shipment Available now
sa42452 Nonsense Mutation detected in F1 DNA During 2017
sa42453 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084114 Essential Splice Site 967 2055 4 23
Genomic Location (Zv9):
Chromosome 14 (position 51433286)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50186054
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCAGGAATCGGCTCAYTCTGACGTCCCGAATAAAAAAGATGCTTCAGG[T/A]AAGTCCTGAAAAATTGAATAATCAATGAAGTCTTTGCAMTCTGAAKATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084114 Nonsense 1449 2055 15 23
Genomic Location (Zv9):
Chromosome 14 (position 51455120)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50207888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGGAAAGAAGCCCCATTACAAGGACATACTGTGGGTCAAAGTGGGA[C/T]GATACAGGTGTGTTTCATCAGGACTTTTTCCACATCAAAGCTGCACAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084114 Nonsense 1489 2055 16 23
Genomic Location (Zv9):
Chromosome 14 (position 51456304)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50209072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTCGGAGAGTTTCCCGTGCACTTCTTCGGCTCTAAAGACTACGTGTG[G/A]ACGTATCAGGCTCGATGTTTCCCCTATATGGAAGGAGACGCCAACAATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link