f2r

Ensembl ID:
ENSDARG00000060012
ZFIN ID:
ZDB-GENE-060526-30
Description:
proteinase-activated receptor 1 [Source:RefSeq peptide;Acc:NP_001108318]
Human Orthologue:
F2R
Human Description:
coagulation factor II (thrombin) receptor [Source:HGNC Symbol;Acc:3537]
Mouse Orthologue:
F2r
Mouse Description:
coagulation factor II (thrombin) receptor Gene [Source:MGI Symbol;Acc:MGI:101802]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20518 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084112 Nonsense 331 413 2 2
Genomic Location:
Chromosome 5 (position 47808892)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACACCAACAAACATCATCTTACTGTCACATTATGTGAGGTTTGCTTA[C/A]AAGCACAATGACGCGTCCTATGCCGCTTACCTGGTCTCCATGTGTATGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ywr6innl