iqgap2

Ensembl ID:
ENSDARG00000060010
ZFIN ID:
ZDB-GENE-030131-2878
Description:
IQ motif containing GTPase activating protein 2 [Source:RefSeq peptide;Acc:NP_001121812]
Human Orthologue:
IQGAP2
Human Description:
IQ motif containing GTPase activating protein 2 [Source:HGNC Symbol;Acc:6111]
Mouse Orthologue:
Iqgap2
Mouse Description:
IQ motif containing GTPase activating protein 2 Gene [Source:MGI Symbol;Acc:MGI:2449975]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38499 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1554 Nonsense Available for shipment Available now
sa33696 Nonsense Mutation detected in F1 DNA During 2016
sa40546 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38499
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084069 Essential Splice Site 112 1526 3 34
ENSDART00000138055 Essential Splice Site 139 1680 4 38
Genomic Location (Zv9):
Chromosome 5 (position 47725806)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45514546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACACCGTGCAGTGGCTCAGAGCCATGGAGTCCATTGGTTTGCCCAAGG[T/C]GAGGCCCACACATACACACACAGACACACACACCTCTTTGAAGATAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084069 Nonsense 719 1526 18 34
ENSDART00000138055 Nonsense 746 1680 19 38
Genomic Location (Zv9):
Chromosome 5 (position 47773076)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45561816
KASP Assay ID:
554-1497.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCNTTTTTTTTATAAATAGAATGTTTTGAGCAGTGTAACAGCGGAGTA[T/G]AATAGAGAGCAGCTGTGGTTGGCCAATGAGCCGTTTATCATCCAGCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084069 Nonsense 1178 1526 28 34
ENSDART00000138055 Nonsense 1204 1680 29 38
Genomic Location (Zv9):
Chromosome 5 (position 47785679)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45574419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCTGTCTTCTTCCCTCAGATTGTAGGGACTCTTCTGTATTACCGCTA[C/A]ATGAATCCTGCCATTGTGGCTCCAGACGGCTTTGACATCATTGACATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084069 Essential Splice Site 1246 1526 28 34
ENSDART00000138055 Essential Splice Site 1272 1680 29 38
Genomic Location (Zv9):
Chromosome 5 (position 47785884)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45574624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCACTCCCATGAACAGCTACATCTCCCAGACCTACCAGAAATTCAGG[T/C]GAGGAGAACAGAGCTTCTCATCAGTATCCGTCTTTACATCAAATGTAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link