nedd4l

Ensembl ID:
ENSDARG00000060006
ZFIN ID:
ZDB-GENE-051118-2
Description:
Novel protein similar to vertebrate neural cell expressed, developmentally down-regulated 4 (NEDD4)
Human Orthologue:
NEDD4L
Human Description:
neural precursor cell expressed, developmentally down-regulated 4-like [Source:HGNC Symbol;Acc:7728]
Mouse Orthologue:
Nedd4l
Mouse Description:
neural precursor cell expressed, developmentally down-regulated gene 4-like Gene [Source:MGI Symbol;

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43589 Nonsense Mutation detected in F1 DNA During 2017
sa37245 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14628 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43589
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084061 Nonsense 6 1011 1 33
ENSDART00000146576 Nonsense 6 988 1 31
Genomic Location (Zv9):
Chromosome 21 (position 9589909)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 10961962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGTATGTGTGTGTTAAATTGCCTTTTGGCTTTATGGCTACGAATTTT[G/T]AACCCATTTATGGACTTTCAGAGGATGAAGTAAGTACTGTTTTTTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084061 Essential Splice Site 187 1011 9 33
ENSDART00000146576 Essential Splice Site 170 988 8 31
Genomic Location (Zv9):
Chromosome 21 (position 9490018)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 10862071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGGAGGACATGAGGAGGAAAGCGGTGAAATGAGAGAGGAGGCTGAGG[T/C]GAAGTATATCCATCCACACACTCATTTTTTTTATTAATACCGTAGTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084061 Essential Splice Site 625 1011 20 33
ENSDART00000146576 Essential Splice Site 602 988 19 31
Genomic Location (Zv9):
Chromosome 21 (position 9442760)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 10814813
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACACAGTGGGAAGACCCTCGTCTCCAGAGTCCTGCCATAACTGGACCC[G/T]TAAGTGTTTTTCTCKTATTTTGCAGTCACAATCTGTCTCTTTCTGTATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link