mtrf1l

Ensembl ID:
ENSDARG00000060005
ZFIN ID:
ZDB-GENE-030131-8198
Description:
Novel protein similar to H.sapiens MTRF1L, mitochondrial translational release factor 1-like (MTRF1L
Human Orthologue:
MTRF1L
Human Description:
mitochondrial translational release factor 1-like [Source:HGNC Symbol;Acc:21051]
Mouse Orthologue:
Mtrf1l
Mouse Description:
mitochondrial translational release factor 1-like Gene [Source:MGI Symbol;Acc:MGI:1918830]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42298 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084094 Nonsense 115 339 4 8
Genomic Location (Zv9):
Chromosome 13 (position 47388383)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46640388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGAAGCCATGCTGTTTACCGCAGAGATCTTCGAGATGTACCAGAACTA[T/A]GCTGCTTTCAATGGCTGGAGCTTTGACGTCCTGGAGGCCAATGCTAGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link