fzd7a

Ensembl ID:
ENSDARG00000060004
ZFIN ID:
ZDB-GENE-990415-223
Description:
frizzled homolog 7a [Source:RefSeq peptide;Acc:NP_571214]
Human Orthologue:
FZD7
Human Description:
frizzled homolog 7 (Drosophila) [Source:HGNC Symbol;Acc:4045]
Mouse Orthologue:
Fzd7
Mouse Description:
frizzled homolog 7 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108570]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
e3 Nonsense Confirmed mutation in F2 line Unknown
sa10339 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
e3
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084055 Nonsense 260 559 1 1
Genomic Location:
Chromosome 9 (position 13630055)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGGTCAATTTTGTGCTGTGTTAGCACTTTGTTCACCGTCCTCACTTA[T/A]TTAGTGGACATGAGGCGGTTTCGTTACCCGGAGAGGCCCATCATCTTCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084055 Nonsense 540 559 1 1
Genomic Location:
Chromosome 9 (position 13629217)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCGTAGGGATCACCTCTGGATTTTGGATATGGTCTGGAAAAACTCTG[C/T]AGTCGTGGCGCAGGTTTTATAAACGGCTCAGCAACAGCAACCAGGGCGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q7g2ux8h