TRPM4 (1 of 3)

Ensembl ID:
ENSDARG00000059993
Description:
transient receptor potential cation channel, subfamily M, member 4 [Source:HGNC Symbol;Acc:17993]
Human Orthologue:
TRPM4
Human Description:
transient receptor potential cation channel, subfamily M, member 4 [Source:HGNC Symbol;Acc:17993]
Mouse Orthologue:
Trpm4
Mouse Description:
transient receptor potential cation channel, subfamily M, member 4 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25252 Nonsense Mutation detected in F1 DNA During 2014
sa8128 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8129 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25252
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083969 Nonsense 11 1194 3 29
Genomic Location:
Chromosome 3 (position 32631562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCGAAAATGACTCATACTTCACTGTGTAATGTCTGCATTGTAGAGTTG[G/A]ATCCCAAAGATGATTAAAAAGAGAGTGTGCACCACCTTTGTGGAGGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083969 Essential Splice Site 384 1194 12 29
Genomic Location:
Chromosome 3 (position 32643818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGGGTCAGATGACTTTGACACAATCATCCTGAAAGCTCTTGTAAGAGG[T/C]GAGATTAAATCAGCTGCTTTGAGAATTCAAGACATTTYCAGAATGCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083969 Nonsense 662 1194 18 29
Genomic Location:
Chromosome 3 (position 32647576)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTTCAAGCTYCTCATCAGACAGTCTCCTATATGGGGTGGTGCCACCTG[T/A]CTGCAGATGGCCACATCGGCAGACGCACGCCTCTTCTTCAGCCATGATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/omlr053a