TRPM4 (1 of 3)

Ensembl ID:
ENSDARG00000059993
Description:
transient receptor potential cation channel, subfamily M, member 4 [Source:HGNC Symbol;Acc:17993]
Human Orthologue:
TRPM4
Human Description:
transient receptor potential cation channel, subfamily M, member 4 [Source:HGNC Symbol;Acc:17993]
Mouse Orthologue:
Trpm4
Mouse Description:
transient receptor potential cation channel, subfamily M, member 4 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25252 Nonsense Mutation detected in F1 DNA During 2016
sa33216 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25252
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083969 Nonsense 11 1194 3 29
Genomic Location (Zv9):
Chromosome 3 (position 32631562)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32362872
KASP Assay ID:
554-7636.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCGAAAATGACTCATACTTCACTGTGTAATGTCTGCATTGTAGAGTTG[G/A]ATCCCAAAGATGATTAAAAAGAGAGTGTGCACCACCTTTGTGGAGGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083969 Nonsense 150 1194 7 29
Genomic Location (Zv9):
Chromosome 3 (position 32639307)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32370617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAACTTTTTTTGTTGTTTTTTTCCCCCTTGTCTTTTAATGCAGGGGCTT[G/A]GATCATGACGTCAGGTCTGAAGGAGGGTGTTAGCCGTTGTGTAGGTGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link