si:ch73-289a15.4

Ensembl ID:
ENSDARG00000059987
ZFIN ID:
ZDB-GENE-090311-9
Human Orthologue:
DNAH12
Human Description:
dynein, axonemal, heavy chain 12 [Source:HGNC Symbol;Acc:2943]
Mouse Orthologue:
Dnahc12
Mouse Description:
dynein, axonemal, heavy chain 12 Gene [Source:MGI Symbol;Acc:MGI:107720]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43947 Nonsense Mutation detected in F1 DNA During 2017
sa9091 Nonsense Mutation detected in F1 DNA During 2017
sa29902 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24295 Essential Splice Site, Missense Available for shipment Available now
sa17291 Essential Splice Site Available for shipment Available now
sa17673 Nonsense Available for shipment Available now
sa13034 Essential Splice Site Available for shipment Available now
sa37669 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084477 Nonsense 128 3515 4 68
ENSDART00000134012 Nonsense 408 3841 8 69
Genomic Location (Zv9):
Chromosome 23 (position 19839190)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19624297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCAGAGACAGAGCTTTGAAAGTCCCTGAAACGACAGAGGAAATGATG[G/T]AAATGATTACTTACATTAATCAGGTGAAAACCAAAGGAATAGAGGAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084477 Nonsense 321 3515 10 68
ENSDART00000134012 Nonsense 624 3841 12 69
Genomic Location (Zv9):
Chromosome 23 (position 19836999)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19622106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTAGAGAGATGTACAAGATGCTGAAGTTCTTCCAGCAGAAACWGAAG[A/T]AGGCAGAGCTARAGAAGGARAAAACAGCAGGACTAAAGAAGAAGACCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084477 Essential Splice Site 1214 3515 27 68
ENSDART00000134012 Essential Splice Site 1540 3841 28 69
Genomic Location (Zv9):
Chromosome 23 (position 19824399)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19609506
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTTTTAAATCGGTTTGTGTATTCATTAATTCTTTTATTTCATTTTA[G/A]CTATGCCTCATGAGCGGGGAGATTATTCAGATGTCCAGTCAGATGAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084477 Essential Splice Site 2174 3515 None 68
ENSDART00000134012 Missense 2500 3841 44 69
Genomic Location (Zv9):
Chromosome 23 (position 19817377)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19602484
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCATCCCGGCTCTCGAGGCTGCGCTGTCTGCCCTGGACACACTCAAGG[T/G]CAGTTATGCATTTCACATACTGCTTTTCACATGCTAAAAAAGCAAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084477 Essential Splice Site 2248 3515 45 68
ENSDART00000134012 Essential Splice Site 2574 3841 46 69
Genomic Location (Zv9):
Chromosome 23 (position 19814234)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19599341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGAATTTCCTCAGAGACTTGAAGGAAWATGACAAAGATAACATCCCTG[T/A]AAGTCTTTTTTGCAGTGTGTGTGYTTCATAACACTGRCTRAGGTATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084477 Nonsense 3154 3515 61 68
ENSDART00000134012 Nonsense 3480 3841 62 69
Genomic Location (Zv9):
Chromosome 23 (position 19801417)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19586524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACTGGGACCGTCGCCTCCTCATGACGATCCTCGCTGACTTCTACAAC[A/T]AAGAYGTTATTGACCACCCACGCTACTCCTTCTCYCCTAGTGGCAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13034
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084477 Essential Splice Site 3249 3515 62 68
ENSDART00000134012 Essential Splice Site 3575 3841 63 69
Genomic Location (Zv9):
Chromosome 23 (position 19799122)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19584229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCGGAGACAGCACCCTTCTGGAYAKTGCTAATGACATCCTTTCTAAAG[T/C]AACTCGTCCTTTATTAAATTATACATTGTTATTRGCATAYAAATGCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084477 Nonsense 3340 3515 64 68
ENSDART00000134012 Nonsense 3666 3841 65 69
Genomic Location (Zv9):
Chromosome 23 (position 19798669)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19583776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGTGGGCCAAATGCTCCTATCCCAGTCTCAAGCCATTGGGTAGCTA[T/A]GTCAATGACTTCCTGGCCAGACTCAAGTTTTTGCAGGTCAGTGACCACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link