cplx4a

Ensembl ID:
ENSDARG00000059978
ZFIN ID:
ZDB-GENE-060526-116
Description:
complexin-4 [Source:RefSeq peptide;Acc:NP_001070768]
Human Orthologue:
CPLX4
Human Description:
complexin 4 [Source:HGNC Symbol;Acc:24330]
Mouse Orthologue:
Cplx4
Mouse Description:
complexin 4 Gene [Source:MGI Symbol;Acc:MGI:2685803]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14594 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14594
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084011 Nonsense 26 159 1 3
Genomic Location:
Chromosome 21 (position 9275604)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TKGGGAACCCATTGAAAGGAATGGGACTTGGAGGAGGAGATGAAAAGGCT[G/T]AAGAGGAGACCCCTAAAGACCCTGCKGCCGCYGCYGGGATGACTCGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x7g2qwv2