fbxo11

Ensembl ID:
ENSDARG00000059973
ZFIN ID:
ZDB-GENE-061103-70
Description:
F-box protein 11 [Source:RefSeq peptide;Acc:NP_001153140]
Human Orthologue:
FBXO11
Human Description:
F-box protein 11 [Source:HGNC Symbol;Acc:13590]
Mouse Orthologue:
Fbxo11
Mouse Description:
F-box protein 11 Gene [Source:MGI Symbol;Acc:MGI:2147134]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35593 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083989 Nonsense 54 844 2 21
ENSDART00000088099 Nonsense 54 879 2 22
ENSDART00000139490   None 233 None 6

The following transcripts of ENSDARG00000059973 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 49355031)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48115007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTGCAGAAGAATCTGGTCAAGGTGCTCAAAATAGTCCGTACCAACTT[C/T]GAAGAAAATCTCTATTACCGAAGAGAACAGCTTGTCCAACAAAGACCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link