fbxo11

Ensembl ID:
ENSDARG00000059973
ZFIN ID:
ZDB-GENE-061103-70
Description:
F-box protein 11 [Source:RefSeq peptide;Acc:NP_001153140]
Human Orthologue:
FBXO11
Human Description:
F-box protein 11 [Source:HGNC Symbol;Acc:13590]
Mouse Orthologue:
Fbxo11
Mouse Description:
F-box protein 11 Gene [Source:MGI Symbol;Acc:MGI:2147134]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4536 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083989 Nonsense 519 844 13 21
ENSDART00000088099 Nonsense 519 879 13 22
ENSDART00000139490 None None 233 None 6

The following transcripts of ENSDARG00000059973 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 49368881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTACATTTTCGGCGACGGCCGAGGGCTCATTGAAGGGAACGACATCTA[T/G]GGCAATGCATTAGCTGGAATCCAGATCCGGACCAACAGCTGCCCGATCGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ogqzt0yy