si:ch211-141h20.2

Ensembl ID:
ENSDARG00000059965
ZFIN ID:
ZDB-GENE-070912-80
Human Orthologue:
CAMSAP1L1
Human Description:
calmodulin regulated spectrin-associated protein 1-like 1 [Source:HGNC Symbol;Acc:29188]
Mouse Orthologue:
Camsap1l1
Mouse Description:
calmodulin regulated spectrin-associated protein 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:1922434]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33015 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6020 Nonsense Mutation detected in F1 DNA During 2017
sa14892 Nonsense Available for shipment Available now
sa33016 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33017 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083957 Essential Splice Site 56 1407 None 18
ENSDART00000135582   None 93 None 2
ENSDART00000139154   None 325 None 6
ENSDART00000144704 Essential Splice Site 47 187 None 3
ENSDART00000147245   None 124 None 3
Genomic Location (Zv9):
Chromosome 2 (position 45346966)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45447654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATATCCTGCAGTTTGACGTGGCTCATCGCCAAAGCCTTTGGATCTGG[T/G]AGGTGGCGCTTAAAGGTTTGAAAATGCACATTTTGAGTTCAGGGGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083957 Nonsense 1033 1407 12 18
ENSDART00000135582   None 93 None 2
ENSDART00000139154   None 325 None 6
ENSDART00000144704   None 187 None 3
ENSDART00000147245   None 124 None 3
Genomic Location (Zv9):
Chromosome 2 (position 45414764)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45506474
KASP Assay ID:
554-3917.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAAGCATTGACATCTGAGGTCACGGCCAGTGGGAACACAAATGAAGAA[G/T]AGTCTGAGGAGAGTAAGGAKTTRATTGAGGTKCCTCTCTCGGTTCTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14892
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083957 Nonsense 1226 1407 15 18
ENSDART00000135582   None 93 None 2
ENSDART00000139154 Nonsense 145 325 3 6
ENSDART00000144704   None 187 None 3
ENSDART00000147245   None 124 None 3
Genomic Location (Zv9):
Chromosome 2 (position 45425552)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45517218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCAGCATATCACTCGCCTCCCTGAACTTAGCAGACAATGAGAGCATC[C/T]AATCAGATAAGAGAACATCCAGGTRAGACTRWGGCTAATTTACTGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083957 Essential Splice Site 1233 1407 15 18
ENSDART00000135582   None 93 None 2
ENSDART00000139154 Essential Splice Site 152 325 3 6
ENSDART00000144704   None 187 None 3
ENSDART00000147245   None 124 None 3
Genomic Location (Zv9):
Chromosome 2 (position 45425575)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45517241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAACTTAGCAGACAATGAGAGCATCCAATCAGATAAGAGAACATCCAG[G/A]TGAGACTGTGGCTAATTTACTGTAAAATATCATTCAAGTACAATGACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083957 Essential Splice Site 1269 1407 16 18
ENSDART00000135582   None 93 None 2
ENSDART00000139154 Essential Splice Site 188 325 4 6
ENSDART00000144704   None 187 None 3
ENSDART00000147245   None 124 None 3
Genomic Location (Zv9):
Chromosome 2 (position 45429620)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45521286
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGAGCTGGAATCAACATCATCCGCAGCATCTAACACAGAATACACAG[G/A]TAAGATGACAGTCCTGCAGTATTATATGAACCTATTATATTCCATCTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Epilepsy: Two-stage genome-wide association study identifies variants in CAMSAP1L1 as susceptibility loci for epilepsy in Chinese. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link