si:ch211-254o18.3

Ensembl ID:
ENSDARG00000059963
ZFIN ID:
ZDB-GENE-060526-137
Description:
Novel protein similar to vertebrate polymerase (DNA directed) kappa (POLK) [Source:UniProtKB/TrEMBL;
Human Orthologue:
POLK
Human Description:
polymerase (DNA directed) kappa [Source:HGNC Symbol;Acc:9183]
Mouse Orthologue:
Polk
Mouse Description:
polymerase (DNA directed), kappa Gene [Source:MGI Symbol;Acc:MGI:1349767]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40543 Nonsense Mutation detected in F1 DNA During 2017
sa26563 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40544 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017
sa10869 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40543
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083937 Nonsense 53 846 2 17
ENSDART00000141039 Nonsense 53 875 2 13
Genomic Location (Zv9):
Chromosome 5 (position 47508589)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45297329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATATAATTAATTTTTTTCTAATTTATAGGGATCTAGATTTTATGAGAAT[G/T]AATTGAAGAAAGAGCGGCAGGTGAATCAGCGCATTGAAAAGATGATGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083937 Essential Splice Site 137 846 4 17
ENSDART00000141039 Essential Splice Site 137 875 4 13
Genomic Location (Zv9):
Chromosome 5 (position 47512903)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45301643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGATTAATCATGCTGCTCTAGTTGACGTTATAATCTTTTATTCTTTTC[A/T]GTCAACCTCCAATTATCATGCCAGAAGGTTTGGTGTCCGTGCTGCCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40544
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083937 Essential Splice Site 599 846 None 17
ENSDART00000141039 Missense 594 875 12 13
Genomic Location (Zv9):
Chromosome 5 (position 47521464)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45310204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTCTCAATCAGACACAACATCGGCTAACAAAATGAATACAGGATACA[T/C]AAGCAAACTTGCAAAGGCGTCATTTAAGATTTCGACCCAGGTGCTGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083937   None 846 None 17
ENSDART00000141039 Nonsense 834 875 13 13
Genomic Location (Zv9):
Chromosome 5 (position 47525436)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45314176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGACAAATTCTTCAGAGGAAACACCAGACAGAACGTCTAATTCTGCTA[C/T]AAATCCACACAGACCATATCCAGAAAATAKGAAGAAGAGACATGATAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link