si:ch211-251b21.2

Ensembl ID:
ENSDARG00000059960
ZFIN ID:
ZDB-GENE-081105-108
Description:
Novel protein similar to H.sapiens PLCH2, phospholipase C, eta 2 (PLCH2) [Source:UniProtKB/TrEMBL;Ac
Human Orthologue:
PLCH2
Human Description:
phospholipase C, eta 2 [Source:HGNC Symbol;Acc:29037]
Mouse Orthologue:
Plch2
Mouse Description:
phospholipase C, eta 2 Gene [Source:MGI Symbol;Acc:MGI:2443078]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34490 Nonsense Mutation detected in F1 DNA During 2017
sa25407 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007624 Nonsense 489 1020 10 22
ENSDART00000131460 Nonsense 6 537 1 14

The following transcripts of ENSDARG00000059960 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 49730258)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47582235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTCTACTGTATGTGTTTGTTTGTGTTTACAGGGCAAGAAACTACCCT[C/A]AAATATAGATGAGAACGCAGAGGAGGGGGACGTGTCTGATGAAGACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007624 Nonsense 632 1020 13 22
ENSDART00000131460 Nonsense 149 537 4 14

The following transcripts of ENSDARG00000059960 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 49750292)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47602269
KASP Assay ID:
554-7584.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGGACACCGACACCGATCAGGAGAGCTCAAGCGGGGCATCTAAAGCA[C/T]AAGCACATCACAGCAGGTACCATTTAGAATTACTCTTGATGATTAGATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link