ptk6b

Ensembl ID:
ENSDARG00000059956
ZFIN ID:
ZDB-GENE-060929-1150
Description:
PTK6 protein tyrosine kinase 6b [Source:RefSeq peptide;Acc:NP_001070140]
Human Orthologue:
PTK6
Human Description:
PTK6 protein tyrosine kinase 6 [Source:HGNC Symbol;Acc:9617]
Mouse Orthologue:
Ptk6
Mouse Description:
PTK6 protein tyrosine kinase 6 Gene [Source:MGI Symbol;Acc:MGI:99683]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24286 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083947 Nonsense 383 511 6 8
Genomic Location (Zv9):
Chromosome 23 (position 17570985)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17473924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAGGGACCTCGCTGCCAGAAATGTGCTTGTAGGAGATGGATATGTCTG[C/A]AAAATTGCTGATTTTGGCCTAGCTCGAATCATTAAGGTAAGATTGATTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link