D3HU68_DANRE

Ensembl ID:
ENSDARG00000059949
Description:
Protein tyrosine phosphatase lambda B [Source:UniProtKB/TrEMBL;Acc:D3HU68]
Human Orthologue:
PTPRU
Human Description:
protein tyrosine phosphatase, receptor type, U [Source:HGNC Symbol;Acc:9683]
Mouse Orthologue:
Ptpru
Mouse Description:
protein tyrosine phosphatase, receptor type, U Gene [Source:MGI Symbol;Acc:MGI:1321151]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9765 Nonsense Available for shipment Available now
sa42777 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9765
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036656 Nonsense 147 898 3 18
ENSDART00000083939 Nonsense 147 888 3 17
Genomic Location (Zv9):
Chromosome 16 (position 37828386)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 35115732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGGAGGTCAATGCTGGACAAAACGCCACTTTCCAGTGTGTGGCAGCT[G/T]GACGTCCCTCWGAAGCTGAGAAGTTCCTTTTGGAGGTGAGTATTTGAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036656 Essential Splice Site 217 898 5 18
ENSDART00000083939 Essential Splice Site 217 888 5 17
Genomic Location (Zv9):
Chromosome 16 (position 37844059)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 35100059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATAGAGTTTTACTATAATCTCCTTTCTTTCTGTCTATTTCTGTCACA[G/A]TTCCCCCATCGCCCATTGCTCCACCACAGCTGTTGAGAGCGGGTTCCACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link