LOC568033

Ensembl ID:
ENSDARG00000059945
Human Orthologue:
SV2A
Human Description:
synaptic vesicle glycoprotein 2A [Source:HGNC Symbol;Acc:20566]
Mouse Orthologue:
Sv2a
Mouse Description:
synaptic vesicle glycoprotein 2 a Gene [Source:MGI Symbol;Acc:MGI:1927139]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5627 Essential Splice Site F2 line generated During 2016
sa2868 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa5627
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083919 Essential Splice Site 452 734 7 12
ENSDART00000083919 Essential Splice Site 452 734 7 12
Genomic Location (Zv9):
Chromosome 16 (position 49249824)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 46219045
KASP Assay ID:
554-3143.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGATCACCTACATGATGATGGCCGTGTGGTTTTCCATGTCCTTCAGG[T/C]ACACTATGCAATATTTRGCTTCCAGCAGCTTCCAGTGATATTTTTCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2868
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083919 Essential Splice Site 452 734 7 12
ENSDART00000083919 Essential Splice Site 452 734 7 12
Genomic Location (Zv9):
Chromosome 16 (position 49249824)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 46219045
KASP Assay ID:
554-3143.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGATCACCTACATGATGATGGCCGTGTGGTTTTCCATGTCCTTCAGG[T/C]ACACTATGCAATATTTRGCTTCCAGCAGCTTCCAGTGATATTTTTCCCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link