c1qtnf2

Ensembl ID:
ENSDARG00000059944
ZFIN ID:
ZDB-GENE-030131-5133
Human Orthologue:
C1QTNF2
Human Description:
C1q and tumor necrosis factor related protein 2 [Source:HGNC Symbol;Acc:14325]
Mouse Orthologue:
C1qtnf2
Mouse Description:
C1q and tumor necrosis factor related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1916433]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1740 Essential Splice Site Available for shipment Available now
sa12217 Nonsense Available for shipment Available now
sa7397 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083928 Essential Splice Site 80 292 1 2
Genomic Location:
Chromosome 14 (position 48956708)
KASP Assay ID:
554-1685.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGGGCAGGATGGAAAGGATGGAGACGGGGGTGAAAAGGGAGAGAAAG[G/A]TGAAGCATATTTGTTGTGGCTGTCATAAGGTTAATGAAAAATAAACAGTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa12217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083928 Nonsense 193 292 2 2
Genomic Location:
Chromosome 14 (position 48958428)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTACAACTCCACCAGTGGCAAGTTTAACTGCGTYATTCCCGGTGTTTA[T/G]TACTTTACGTRCGACWTCACATTGGCGAATAAACACCTGRCAATTGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083928 Missense 272 292 2 2
Genomic Location:
Chromosome 14 (position 48958664)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGCTGTTTTTCGATCCGTTCTGGACTGACAGCCTTTTCACAGGATTTC[T/G]CATTTTTGCTGATCAGGCTGAACSRCCGAATRAGAAGATGACGAAYAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rticmexc