dab1a

Ensembl ID:
ENSDARG00000059939
ZFIN ID:
ZDB-GENE-060528-1
Description:
disabled homolog 1a (Drosophila) (dab1a), mRNA [Source:RefSeq DNA;Acc:NM_001040685]
Human Orthologue:
DAB1
Human Description:
disabled homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:2661]
Mouse Orthologue:
Dab1
Mouse Description:
disabled homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108554]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14868 Essential Splice Site Available for shipment Available now
sa43385 Essential Splice Site Mutation detected in F1 DNA During 2017
sa15478 Essential Splice Site Available for shipment Available now
sa36975 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36974 Missense, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083906   None 543 None 17
ENSDART00000083908 Essential Splice Site None 541 1 24
ENSDART00000145841 Essential Splice Site None 537 1 13

The following transcripts of ENSDARG00000059939 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 8596902)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8431171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGATTTTTATCATGAGAAGTATGGAATCTGAACGCACTACTTTAAAGG[T/C]AAGRCGGTTTGTCTTGTGGATGACATATGGAAAGAAAAACRGCGCTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083906 Essential Splice Site 146 543 4 17
ENSDART00000083908 Essential Splice Site 146 541 5 24
ENSDART00000145841 Essential Splice Site 146 537 5 13

The following transcripts of ENSDARG00000059939 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 8374323)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8208592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGGAAAGAGGGAAACCATCGGTTTGTGGCCATCAAAACGGCTCAGTCT[G/A]TAAGTACTCAGGCCTGAGAATTGCGAGTGTCATAAACCAGACTTTGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083906 Essential Splice Site 186 543 None 17
ENSDART00000083908 Essential Splice Site 186 541 None 24
ENSDART00000145841 Essential Splice Site 186 537 None 13

The following transcripts of ENSDARG00000059939 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 8371368)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8205637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGAAGAAAGCTCAGAAAGACAAACAGTGCGAACAWGCTGTTTATCAGG[T/A]AACACWCTCACCATAAACCTTYATGAACTCAAAGCCTTAAAGAGAATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083906 Essential Splice Site 199 543 None 17
ENSDART00000083908 Essential Splice Site 199 541 None 24
ENSDART00000145841 Essential Splice Site 199 537 None 13

The following transcripts of ENSDARG00000059939 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 8367606)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8201875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCTGCAGACGATTCTGGAGGAAGATGTGGAGGATCCCGTGTATCAGG[T/C]AACGCTTTGAAATAAACCGTGAATCATTATGTCTGACTGAACGATTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083906 Splice Site None 543 None 17
ENSDART00000083908   444 541 11 24
ENSDART00000145841 Missense 445 537 10 13

The following transcripts of ENSDARG00000059939 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 8332139)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8166408
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACACGGATGACTGTGACGACTTCGATATCTCGCAGATGAACCTCACA[C/T]CCGTCACCTCCACCACACCCTCCACCAACTCACGTGAGTAGTGCCAATTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link