herc4

Ensembl ID:
ENSDARG00000059936
Human Orthologue:
HERC4
Human Description:
hect domain and RLD 4 [Source:HGNC Symbol;Acc:24521]
Mouse Orthologue:
Herc4
Mouse Description:
hect domain and RLD 4 Gene [Source:MGI Symbol;Acc:MGI:1914595]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12438 Nonsense Available for shipment Available now
sa17790 Essential Splice Site Available for shipment Available now
sa24948 Nonsense Mutation detected in F1 DNA During 2014
sa7738 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083883 Nonsense 163 1053 4 23
Genomic Location:
Chromosome 13 (position 51408080)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATCTGAAATGATGTATTCCTCCAGGAGGCGAGMTATTCTCCTGGGGC[C/T]AGAATAAGTATGGTCAGCTGGGTCTGGGGCAGCAGGGAGCCTGTGTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083883 Essential Splice Site 605 1053 14 23
Genomic Location:
Chromosome 13 (position 51381877)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATAATTCTGCAGTGATCATTTTCTGATATCGTCTTTATAATCCMGTTGC[A/T]GGWCAATGAGCGTGCCGGACAGATCAWCCAGWATGATAAATTCTWCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083883 Nonsense 639 1053 14 23
Genomic Location:
Chromosome 13 (position 51381773)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTAGACGAGCTGATCGACATCAGGAATGATTATGCGACCTGGTTTCAG[C/T]AGCAGATGTTCTCTGTGGTTGGTTTATGATCATAACAAACACCCACACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7738
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083883 Essential Splice Site 985 1053 22 23
Genomic Location:
Chromosome 13 (position 51365528)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGAGGTTTTTCACGAGCTGCCTTTGGAGAAGAAGAAACAGTTCCTGTG[T/C]AAGTCAATCCTTTTGGAGTTTAGATTACTGAATACTCCTCGTTGGCYCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sogvkao1