LOC567521

Ensembl ID:
ENSDARG00000059935
Human Orthologue:
KCNA10
Human Description:
potassium voltage-gated channel, shaker-related subfamily, member 10 [Source:HGNC Symbol;Acc:6219]
Mouse Orthologue:
Kcna10
Mouse Description:
potassium voltage-gated channel, shaker-related subfamily, member 10 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13375 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083913 Nonsense 513 532 2 2
Genomic Location:
Chromosome 6 (position 49410110)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCTGCTGAGGCTGCCGCAAATCAGAAAAACAGCTCAGAGGAAAAGTAT[G/T]AAAGCAATTACTCKCTGGACAAGAGCAATGGGAACTGGCAGACGGGAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4gz9a60s