si:ch211-257m21.2

Ensembl ID:
ENSDARG00000059925
ZFIN ID:
ZDB-GENE-060526-139
Description:
Novel protein similar to vertebrate ubiquitin specific protease [Source:UniProtKB/TrEMBL;Acc:A2BIA9]
Human Orthologue:
USP24
Human Description:
ubiquitin specific peptidase 24 [Source:HGNC Symbol;Acc:12623]
Mouse Orthologue:
Usp24
Mouse Description:
ubiquitin specific peptidase 24 Gene [Source:MGI Symbol;Acc:MGI:1919936]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36972 Essential Splice Site Available for shipment Available now
sa11303 Nonsense Available for shipment Available now
sa6615 Nonsense Mutation detected in F1 DNA During 2017
sa43384 Nonsense Mutation detected in F1 DNA During 2017
sa15755 Nonsense Available for shipment Available now
sa43383 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36972
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083890 Essential Splice Site 624 2589 16 66
ENSDART00000144729   None 292 None 7
ENSDART00000146135   None 63 None 2
Genomic Location (Zv9):
Chromosome 20 (position 7692869)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7527274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAAATCACACGGTCTTTTATCAAACAAACCTACCAGAAACAGGACAAG[G/A]TAAAGCCACACAGTCTTCGAAAATAACCATCCTGCCTGTTCCATAGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083890 Nonsense 672 2589 17 66
ENSDART00000144729   None 292 None 7
ENSDART00000146135   None 63 None 2
Genomic Location (Zv9):
Chromosome 20 (position 7692609)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7527014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATCCAATGGTCTTTCYGGGWCCACACTGGTTGATGGACGGTATTCCTA[T/A]CAGGAGGTACACTTGATGATCATTAGTTATCATTTGTACAATYGAAWATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083890 Nonsense 676 2589 18 66
ENSDART00000144729   None 292 None 7
ENSDART00000146135   None 63 None 2
Genomic Location (Zv9):
Chromosome 20 (position 7691519)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7525924
KASP Assay ID:
554-4379.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCKGTGAGAATAACAAACWGGTTTTTTYCTTTAATTATTTTGCCAGTATT[T/A]GGAGGGTCACTTGAAGTTCCTTGCGTTCTTCCTSCAAGAGGCCAGTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083890 Nonsense 717 2589 18 66
ENSDART00000144729   None 292 None 7
ENSDART00000146135   None 63 None 2
Genomic Location (Zv9):
Chromosome 20 (position 7691397)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7525802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGATCTGGGAATGCCTGGTATCCGGCATGGATGTTTGTGAGCTGGAT[C/T]GAGAGGTGTGTGGACGATGCAGTGTGATTTTTATTATTATTTTTTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083890 Nonsense 1978 2589 49 66
ENSDART00000144729   None 292 None 7
ENSDART00000146135   None 63 None 2
Genomic Location (Zv9):
Chromosome 20 (position 7645997)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7480503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGACAATGTTGTGGAAGAGTTTGACATGAACGATGAGACTCTGGAGTA[C/A]GAGTGTTTTGGGGGGGAATACAGACCCAAAGTTTATGACCAGTGTAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083890 Nonsense 2001 2589 50 66
ENSDART00000144729   None 292 None 7
ENSDART00000146135   None 63 None 2
Genomic Location (Zv9):
Chromosome 20 (position 7642101)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7476607
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCTTTTTAATGTGTCATGCTATAGCAAACCCTTACCCGGATGTGCGA[C/T]GACGCTACTGGAATGCCTACATGCTGTTCTACCAGCGCATCAGTGACCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link