LOC557593

Ensembl ID:
ENSDARG00000059917
Human Orthologue:
CCNJ
Human Description:
cyclin J [Source:HGNC Symbol;Acc:23434]
Mouse Orthologue:
Ccnj
Mouse Description:
cyclin J Gene [Source:MGI Symbol;Acc:MGI:2443297]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22389 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083857 Nonsense 22 369 1 6
Genomic Location:
Chromosome 13 (position 51438865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGGTGGAAAGGAGAACTTGCAGAGGACATCTATCAGGCCCTGCGATA[C/A]AAAGTTAGTATCCCTGTCAATCATTGCGTTATTTGATTTCCACTAAATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gjl8s2v0