SDR42E2

Ensembl ID:
ENSDARG00000059914
Description:
short chain dehydrogenase/reductase family 42E, member 2 [Source:HGNC Symbol;Acc:35414]
Human Orthologue:
SDR42E2
Human Description:
short chain dehydrogenase/reductase family 42E, member 2 [Source:HGNC Symbol;Acc:35414]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9990 Nonsense Available for shipment Available now
sa2109 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa9990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083850 Nonsense 258 444 6 11
Genomic Location (Zv9):
Chromosome 3 (position 59272160)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58348745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGCGCCCCTCTGGYATCTACGGTCCTGAAGAGAGAAGGCATTTACAC[C/T]GAGTGATGGTGAGTTTTATTATTGTTWTGAAGMAGACCMTGAGAMCGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2109
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083850 Nonsense 324 444 8 11
Genomic Location (Zv9):
Chromosome 3 (position 59280007)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58356592
KASP Assay ID:
554-2999.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCAGGCGTACTTCATCAAYGATGGGGAGTCGGTTAATGTCTTTGARTG[G/A]YTAACACCACTGGTRAGTAGCACATAAACCCAAGCATGTCTATTTAACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link