bbs7

Ensembl ID:
ENSDARG00000059911
ZFIN ID:
ZDB-GENE-030219-90
Description:
Bardet-Biedl syndrome 7 [Source:RefSeq peptide;Acc:NP_001070613]
Human Orthologue:
BBS7
Human Description:
Bardet-Biedl syndrome 7 [Source:HGNC Symbol;Acc:18758]
Mouse Orthologue:
Bbs7
Mouse Description:
Bardet-Biedl syndrome 7 (human) Gene [Source:MGI Symbol;Acc:MGI:1918742]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa908 Essential Splice Site Available for shipment Available now
sa14873 Nonsense Available for shipment Available now
sa6356 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32004 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083833 Essential Splice Site 176 715 5 19
ENSDART00000147537 Essential Splice Site 176 410 5 11
Genomic Location (Zv9):
Chromosome 14 (position 49325398)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47402636
KASP Assay ID:
554-0815.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATTGTGCCCATTTTGGCCTGCCAGGACAGAGTGCTTAGGGTATTGCAG[G/A]TCAGCAAACACAACATTCAGTCCTGTCCATATTTKTTGCATTTTTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083833 Nonsense 225 715 7 19
ENSDART00000147537 Nonsense 225 410 7 11
Genomic Location (Zv9):
Chromosome 14 (position 49323671)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47400909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATGGGACAGCGGATGGGAAACYGGGTCTTGTGCGAATTGCCAAATCT[G/T]GWCCCGTTACTAGCTGGGAACTGGATAATGAAAAGAAAAAAGGAGGTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083833 Essential Splice Site 312 715 9 19
ENSDART00000147537 Essential Splice Site 312 410 9 11
Genomic Location (Zv9):
Chromosome 14 (position 49322432)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47399670
KASP Assay ID:
554-4805.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTKGGAAAGGAAATGTATGATGAAGTTCTTACAACGACTTACACAGG[T/C]TAGATATGGCTATACATGAAAGCATTTTACCATGTGSATAATGAYYAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32004
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083833 Essential Splice Site 504 715 14 19
ENSDART00000147537   None 410 None 11
Genomic Location (Zv9):
Chromosome 14 (position 49317553)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47395112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAACCACTTTCCCTCCATCAAAGGACACACACAATCGAGCAGGAGCGG[T/C]GAGCTTACACACACACTCCTGTTACCTTTCAATAGTCCTGCAAAATGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link