KNDC1 (1 of 2)

Ensembl ID:
ENSDARG00000059910
Description:
kinase non-catalytic C-lobe domain (KIND) containing 1 [Source:HGNC Symbol;Acc:29374]
Human Orthologue:
KNDC1
Human Description:
kinase non-catalytic C-lobe domain (KIND) containing 1 [Source:HGNC Symbol;Acc:29374]
Mouse Orthologue:
Kndc1
Mouse Description:
kinase non-catalytic C-lobe domain (KIND) containing 1 Gene [Source:MGI Symbol;Acc:MGI:1923734]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38217 Nonsense Mutation detected in F1 DNA During 2017
sa38218 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083839 Nonsense 101 474 4 17
ENSDART00000129195 Nonsense 210 579 6 18
Genomic Location (Zv9):
Chromosome Zv9_NA856 (position 29075)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50368058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATGTCTGACCTATGTGTGAATGTGTTCAGGTTGCACCAGTGGACAGT[C/T]GAGCAGAGACTTTGCTGCTGATGCTGCAGGACTCGCCCAGAAAGAGGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083839 Nonsense 468 474 17 17
ENSDART00000129195 Nonsense 573 579 18 18
Genomic Location (Zv9):
Chromosome Zv9_NA856 (position 41592)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50355858
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCCAGACGAGCGACCGGCACGCGCGCAGGATCCAGGACACACTCCGA[C/T]GAGTCAAGGCCTCATTTCAGTGAAGCAGAGCTGGACGTGTTTCCATTACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link