sdc4

Ensembl ID:
ENSDARG00000059906
ZFIN ID:
ZDB-GENE-061111-1
Description:
syndecan-4 [Source:RefSeq peptide;Acc:NP_001041614]
Human Orthologue:
SDC4
Human Description:
syndecan 4 [Source:HGNC Symbol;Acc:10661]
Mouse Orthologue:
Sdc4
Mouse Description:
syndecan 4 Gene [Source:MGI Symbol;Acc:MGI:1349164]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20823 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20823
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083830 Nonsense 181 258 3 4
Genomic Location (Zv9):
Chromosome 6 (position 52620075)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52669080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGTTCAAAACAATGAAGTTTTCTTGCGTGGAGCACCAAACCAAGACT[T/A]GGACAATCACAGCAATGTGCTCATGACTCACGCTGGAGATGATAGCTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Psoriasis: Genome-wide association analysis identifies three psoriasis susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link