TRIM69 (3 of 3)

Ensembl ID:
ENSDARG00000059905
Description:
tripartite motif-containing 69 [Source:HGNC Symbol;Acc:17857]
Human Orthologue:
TRIM69
Human Description:
tripartite motif-containing 69 [Source:HGNC Symbol;Acc:17857]
Mouse Orthologue:
Trim69
Mouse Description:
tripartite motif-containing 69 Gene [Source:MGI Symbol;Acc:MGI:1918178]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22821 Nonsense Mutation detected in F1 DNA During 2016
sa10274 Nonsense Available for shipment Available now
sa36104 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36103 Nonsense Mutation detected in F1 DNA During 2016
sa22820 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083822 Nonsense 11 308 1 6
ENSDART00000123717 Nonsense 11 463 1 6
Genomic Location:
Chromosome 16 (position 23984385)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTACAGCAGGTGAATCATGGCTTCAGCTCTGTCTCTTTACCTCATGTG[T/A]CCGGTGTGTCTGAGTGACTTCAAAGTTCCAGTAAGTTTGCCCTGTGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083822 Nonsense 43 308 1 6
ENSDART00000123717 Nonsense 43 463 1 6
Genomic Location:
Chromosome 16 (position 23984291)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYGAACATGTTCTCTGTCGGCAGTGTGCTTCCAGGTATTTAGAATCCAGC[A/T]AAGGACCTCATAAATGCCCAGAATGCAGACAAAACTTYACCRGGACGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083822 Essential Splice Site 246 308 3 6
ENSDART00000123717 Essential Splice Site 246 463 3 6
Genomic Location:
Chromosome 16 (position 23981953)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATTGGAGTCAGGACTAAAGATAAACCAGCCAGAGAGGTTTTTAGAGG[T/A]AACGTTGTTCTGTAGCACATTCCAGAAACATGTTTAGACTCAGCATGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083822 Nonsense 269 308 5 6
ENSDART00000123717   None 463 None 6
Genomic Location:
Chromosome 16 (position 23979883)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGTTAATTTTCATGAGAATGTTGCAAGTTCATAGTGCAGTCCTAGCT[C/A]AATTTCATGTGTGCAATGTTGCTGTAAACATTTTAACGGTTGTTTTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083822   None 308 None 6
ENSDART00000123717 Essential Splice Site 311 463 5 6
Genomic Location:
Chromosome 16 (position 23979713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTTCCGCTCATGGTTTGGCGAGACATGCTGGGTCCTGTTAAACGAGG[T/C]GAGTTGAGCTTTCATGAACATCTCTAATAAAGAAACACATTTTTATACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link