ntrk3a

Ensembl ID:
ENSDARG00000059897
ZFIN ID:
ZDB-GENE-010126-3
Description:
Tyrosine-protein kinase receptor [Source:UniProtKB/TrEMBL;Acc:B8JLJ1]
Human Orthologue:
NTRK2
Human Description:
neurotrophic tyrosine kinase, receptor, type 2 [Source:HGNC Symbol;Acc:8032]
Mouse Orthologue:
Ntrk2
Mouse Description:
neurotrophic tyrosine kinase, receptor, type 2 Gene [Source:MGI Symbol;Acc:MGI:97384]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12452 Essential Splice Site Available for shipment Available now
sa38713 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30907 Nonsense Mutation detected in F1 DNA During 2017
sa41298 Nonsense Mutation detected in F1 DNA During 2017
sa34500 Nonsense Available for shipment Available now
sa27277 Nonsense Mutation detected in F1 DNA During 2017
sa41299 Nonsense Mutation detected in F1 DNA During 2017
sa15536 Nonsense Available for shipment Available now
sa544 Nonsense F2 line generated During 2017
sa13707 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083790 Essential Splice Site 56 806 None 19
ENSDART00000131732   None 392 None 7

The following transcripts of ENSDARG00000059897 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52039792)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49790179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCCCCAAGCTGGAGTCCGAGGCGGACATGGAGAACGTCACTGACATG[T/A]AAGTCATGCTGGGGGTCATATACACTGAAACAAAAGCGATACATTGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38713
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083790 Essential Splice Site 222 806 7 19
ENSDART00000131732   None 392 None 7

The following transcripts of ENSDARG00000059897 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52054499)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49804886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAATCAGAGCAGACTAGAGTCATCTGACCAATCAGAGTAGAGTATAA[T/A]CATGCGACCAATCTAAGCACAGGAGAGTAATCTGGCCAATCAGAGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083790 Nonsense 257 806 8 19
ENSDART00000131732   None 392 None 7
ENSDART00000083790 Nonsense 257 806 8 19
ENSDART00000131732   None 392 None 7

The following transcripts of ENSDARG00000059897 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52056607)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49806994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACAAATGCAGAATCACCTGCAGATCGGATAACATGGTGGGAGAATCC[G/T]AGGCCTCTGTGGAGCTGGACATATTGTGTAAGTTATCAAGAGACACAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083790 Nonsense 257 806 8 19
ENSDART00000131732   None 392 None 7
ENSDART00000083790 Nonsense 257 806 8 19
ENSDART00000131732   None 392 None 7

The following transcripts of ENSDARG00000059897 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52056607)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49806994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACAAATGCAGAATCACCTGCAGATCGGATAACATGGTGGGAGAATCC[G/T]AGGCCTCTGTGGAGCTGGACATATTGTGTAAGTTATCAAGAGACACAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083790 Nonsense 347 806 9 19
ENSDART00000131732   None 392 None 7

The following transcripts of ENSDARG00000059897 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52059439)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49809826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTCCCACGCACATCAACAACGGCATGTACACGCTGCTGGCCAGAAAT[C/T]AATTCGGAGAGGACAGCAAGGCCGTATCTGCTCATTTCATGCATGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083790 Nonsense 353 806 9 19
ENSDART00000131732   None 392 None 7

The following transcripts of ENSDARG00000059897 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52059457)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49809844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACGGCATGTACACGCTGCTGGCCAGAAATCAATTCGGAGAGGACAGC[A/T]AGGCCGTATCTGCTCATTTCATGCATGAGCCATGGAACGGTGAGTTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083790 Nonsense 650 806 17 19
ENSDART00000131732 Nonsense 236 392 5 7

The following transcripts of ENSDARG00000059897 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52115299)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49865686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCTCAGATGCTGCACATCGCACAGCAGATCGCCGCAGGCATGGTCTA[T/A]CTGGCCTCCCAGCACTTTGTGCACAGAGATCTGGCCACACGAAACTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083790 Nonsense 721 806 18 19
ENSDART00000131732 Nonsense 307 392 6 7

The following transcripts of ENSDARG00000059897 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52121583)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49871970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCRGAGAGTATCATGTATCGGAAGTTYACAACAGMGAGTGATGTCTG[G/A]AGTCTGGGAGTGGTGCTGTGGGAGATCTTTACCTATGGAAAACAGCCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa544
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083790 Nonsense 774 806 19 19
ENSDART00000131732 Nonsense 360 392 7 7

The following transcripts of ENSDARG00000059897 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52125009)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49875396
KASP Assay ID:
554-0454.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGACCCCGGACCTGTCCCAAGGAGGTGTATGACTTGATGCTGGGATGTT[G/A]GCAGAGAGAGCCGCACACCCGACTCAATATTAAAGAGATCCATAACCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083790 Nonsense 785 806 19 19
ENSDART00000131732 Nonsense 371 392 7 7

The following transcripts of ENSDARG00000059897 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52125041)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49875428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGATGCTGGGATGTTRGCAGAGAGAGCCGCACACCCGACTCAATATT[A/T]AAGAGATCCATAACYTACTTCTCAACCTAGCCAARGCATCACCAGTCTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link