eral1

Ensembl ID:
ENSDARG00000059887
ZFIN ID:
ZDB-GENE-060526-84
Description:
GTP-binding protein era homolog [Source:RefSeq peptide;Acc:NP_001122219]
Human Orthologue:
ERAL1
Human Description:
Era G-protein-like 1 (E. coli) [Source:HGNC Symbol;Acc:3424]
Mouse Orthologue:
Eral1
Mouse Description:
Era (G-protein)-like 1 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1889295]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14959 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14959
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083778 Essential Splice Site 161 447 None 11

The following transcripts of ENSDARG00000059887 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 43879529)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTAGTGTAKATAATTGTAAGTATTGTATATATATTTTTATTTTGTTC[A/G]GGTTTTGTTGGATACCCCTGGTCTCACCACACAGATAAAAGCTAAAAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2alkvguv