frmd3

Ensembl ID:
ENSDARG00000059885
ZFIN ID:
ZDB-GENE-070523-1
Description:
Novel protein similar to H.sapiens FRMD3, FERM domain containing 3 (FRMD3) [Source:UniProtKB/TrEMBL;
Human Orthologue:
FRMD3
Human Description:
FERM domain containing 3 [Source:HGNC Symbol;Acc:24125]
Mouse Orthologue:
Frmd3
Mouse Description:
FERM domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2442466]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10479 Nonsense Available for shipment Available now
sa34496 Nonsense Mutation detected in F1 DNA During 2016
sa27276 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10479
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083760 Nonsense 112 603 5 14
ENSDART00000139494   None 117 None 2
ENSDART00000142115 Nonsense 112 380 5 13
Genomic Location (Zv9):
Chromosome 8 (position 51927106)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49677493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTAAWGTCTGCTCTCTCTCTAATTTTCTCTCTATTTTCTCTTTCAGGTA[T/G]CTTCTGTATCTCCAGTTGAAGAGAGACGTGTATCAMGGCAGGCTGTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083760 Nonsense 128 603 5 14
ENSDART00000139494   None 117 None 2
ENSDART00000142115 Nonsense 128 380 5 13
Genomic Location (Zv9):
Chromosome 8 (position 51927059)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49677446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATCTTCTGTATCTCCAGTTGAAGAGAGACGTGTATCACGGCAGGCTGT[T/A]GTGTCCATTCGCTGATGCTGCATATCTCGGAGCCTGCATCGTCCAGGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083760   None 603 None 14
ENSDART00000139494 Essential Splice Site None 117 1 2
ENSDART00000142115   None 380 None 13
Genomic Location (Zv9):
Chromosome 8 (position 51883792)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49634179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCATCTTTCAGGGAATGAATAGGGATGGGAATGAAACCAGAAGGACAG[G/A]TTTGCTCTCCTACATGGGTTATTCATTCACATCTTCTTCTCTTTTTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link