frmd3

Ensembl ID:
ENSDARG00000059885
ZFIN ID:
ZDB-GENE-070523-1
Description:
Novel protein similar to H.sapiens FRMD3, FERM domain containing 3 (FRMD3) [Source:UniProtKB/TrEMBL;
Human Orthologue:
FRMD3
Human Description:
FERM domain containing 3 [Source:HGNC Symbol;Acc:24125]
Mouse Orthologue:
Frmd3
Mouse Description:
FERM domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2442466]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10479 Nonsense Available for shipment Available now
sa27276 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa10479
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083760 Nonsense 112 603 5 14
ENSDART00000139494   None 117 None 2
ENSDART00000142115 Nonsense 112 380 5 13
Genomic Location:
Chromosome 8 (position 51927106)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTAAWGTCTGCTCTCTCTCTAATTTTCTCTCTATTTTCTCTTTCAGGTA[T/G]CTTCTGTATCTCCAGTTGAAGAGAGACGTGTATCAMGGCAGGCTGTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083760   None 603 None 14
ENSDART00000139494 Essential Splice Site None 117 1 2
ENSDART00000142115   None 380 None 13
Genomic Location:
Chromosome 8 (position 51883792)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCATCTTTCAGGGAATGAATAGGGATGGGAATGAAACCAGAAGGACAG[G/A]TTTGCTCTCCTACATGGGTTATTCATTCACATCTTCTTCTCTTTTTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qa2msf16