trpv1

Ensembl ID:
ENSDARG00000059883
ZFIN ID:
ZDB-GENE-030912-8
Description:
transient receptor potential cation channel subfamily V member 1 [Source:RefSeq peptide;Acc:NP_0011
Human Orthologues:
TRPV1, TRPV2
Human Descriptions:
transient receptor potential cation channel, subfamily V, member 1 [Source:HGNC Symbol;Acc:12716]
transient receptor potential cation channel, subfamily V, member 2 [Source:HGNC Symbol;Acc:18082]
Mouse Orthologues:
Trpv1, Trpv2
Mouse Descriptions:
transient receptor potential cation channel, subfamily V, member 1 Gene [Source:MGI Symbol;Acc:MGI:1
transient receptor potential cation channel, subfamily V, member 2 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11782 Nonsense Available for shipment Available now
sa12465 Nonsense Available for shipment Available now
sa33682 Nonsense Mutation detected in F1 DNA During 2016
sa33683 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083731 Nonsense 335 819 7 17
ENSDART00000140743 Nonsense 331 813 6 15
ENSDART00000083731 Nonsense 335 819 7 17
ENSDART00000140743 Nonsense 331 813 6 15
Genomic Location (Zv9):
Chromosome 5 (position 43766575)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41547840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGGGAGCTTATGGGCTGCAGACATCTGTCCCGAAAGATCACGGARTG[G/A]GCCTAYGGTCCAGTGTGCTCSTCTTTGTATGACCTCTCCTCCCTCGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083731 Nonsense 335 819 7 17
ENSDART00000140743 Nonsense 331 813 6 15
ENSDART00000083731 Nonsense 335 819 7 17
ENSDART00000140743 Nonsense 331 813 6 15
Genomic Location (Zv9):
Chromosome 5 (position 43766575)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41547840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGGGAGCTTATGGGCTGCAGACATCTGTCCCGAAAGATCACGGARTG[G/A]GCCTAYGGTCCAGTGTGCTCSTCTTTGTATGACCTCTCCTCCCTCGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083731 Nonsense 452 819 9 17
ENSDART00000140743 Nonsense 446 813 8 15
Genomic Location (Zv9):
Chromosome 5 (position 43767965)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41549230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTAGGGAAGGCTACCTGCTTCTGACAGGACACATCATATCTATCACT[G/T]GAGCATTTTACTTCTTTATTAGAGGGGTGTGTATCTGACGCTCTTGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083731 Essential Splice Site 540 819 12 17
ENSDART00000140743 Essential Splice Site 534 813 11 15
Genomic Location (Zv9):
Chromosome 5 (position 43768791)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41550056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTTACAACCTACTTGTGCATACACTCTTACGCTCTTTAATTATTATC[A/T]GATGGTTCTTGGAGAAATTCGCAGATTCCTTGTTGTGTACATGGTGTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link