trpv1

Ensembl ID:
ENSDARG00000059883
ZFIN ID:
ZDB-GENE-030912-8
Description:
transient receptor potential cation channel subfamily V member 1 [Source:RefSeq peptide;Acc:NP_0011
Human Orthologues:
TRPV1, TRPV2
Human Descriptions:
transient receptor potential cation channel, subfamily V, member 1 [Source:HGNC Symbol;Acc:12716]
transient receptor potential cation channel, subfamily V, member 2 [Source:HGNC Symbol;Acc:18082]
Mouse Orthologues:
Trpv1, Trpv2
Mouse Descriptions:
transient receptor potential cation channel, subfamily V, member 1 Gene [Source:MGI Symbol;Acc:MGI:1
transient receptor potential cation channel, subfamily V, member 2 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11782 Nonsense Available for shipment Available now
sa12465 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083731 Nonsense 335 819 7 17
ENSDART00000140743 Nonsense 331 813 6 15
ENSDART00000083731 Nonsense 335 819 7 17
ENSDART00000140743 Nonsense 331 813 6 15
Genomic Location:
Chromosome 5 (position 43766575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGGGAGCTTATGGGCTGCAGACATCTGTCCCGAAAGATCACGGARTG[G/A]GCCTAYGGTCCAGTGTGCTCSTCTTTGTATGACCTCTCCTCCCTCGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083731 Nonsense 335 819 7 17
ENSDART00000140743 Nonsense 331 813 6 15
ENSDART00000083731 Nonsense 335 819 7 17
ENSDART00000140743 Nonsense 331 813 6 15
Genomic Location:
Chromosome 5 (position 43766575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGGGAGCTTATGGGCTGCAGACATCTGTCCCGAAAGATCACGGARTG[G/A]GCCTAYGGTCCAGTGTGCTCSTCTTTGTATGACCTCTCCTCCCTCGACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hzaokax9