rptor

Ensembl ID:
ENSDARG00000059879
Human Orthologue:
RPTOR
Human Description:
regulatory associated protein of MTOR, complex 1 [Source:HGNC Symbol;Acc:30287]
Mouse Orthologue:
Rptor
Mouse Description:
regulatory associated protein of MTOR, complex 1 Gene [Source:MGI Symbol;Acc:MGI:1921620]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11537 Nonsense Available for shipment Available now
sa18578 Essential Splice Site Available for shipment Available now
sa3575 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083756 Nonsense 443 1363 12 35
Genomic Location:
Chromosome 6 (position 17563454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGAACATTATGCTAATGTTTTTCCATATRTTTTCTCTCAGGTCCTTT[T/G]AAGTCAGGTACACAGGCTGAGGGCGCTGGATTTGCTTGGACGATTTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18578
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083756 Essential Splice Site 802 1363 20 35
Genomic Location:
Chromosome 6 (position 17589762)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACAAGATGAGAAGAGTCAGCTCAKACTCATCCTTAAATTCTCTCATTG[G/A]TAAGATTWCCTTTTTCAGCAGCAGACAAGACCGTTATTGGTTGTTACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083756 Nonsense 1135 1363 28 35
Genomic Location:
Chromosome 6 (position 17629298)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGATGGTCACAGCATGGCAAGGCYTGTCTGACATGCTGCCCACCACA[C/T]GAGGTTTGCTTTTTTATTTTATTATTTTTTTCTTTRTTTGTTTTTGTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mwjtj78n