ABCC1

Ensembl ID:
ENSDARG00000059874
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 1 [Source:HGNC Symbol;Acc:51]
Human Orthologue:
ABCC1
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 1 [Source:HGNC Symbol;Acc:51]
Mouse Orthologue:
Abcc1
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 1 Gene [Source:MGI Symbol;Acc:MGI:102676]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10834 Nonsense Available for shipment Available now
sa33242 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40113 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6039 Nonsense Mutation detected in F1 DNA During 2016
sa2103 Essential Splice Site F2 line generated During 2016
sa33241 Nonsense Mutation detected in F1 DNA During 2016
sa40112 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10834
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083659 Nonsense 53 1529 2 34
Genomic Location:
Chromosome 3 (position 36473717)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTGGTTTGGATACCCTGTCTCTACCTCTGGCTTTTTGCACCACTCTA[C/A]ATCCTATACCTCAAAAGCCATGATCGCGGATACATATGCATGACCCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083659 Essential Splice Site 405 1529 9 34
Genomic Location:
Chromosome 3 (position 36469300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTGGCATGAGGTTACGCACAGCCATAGTTGGTGCTGTATACAGAAAA[G/A]TAAGTGTAGTTTTAATTGATTGATTGATAAAAATGCATGACATGCATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083659 Essential Splice Site 459 1529 10 34
Genomic Location:
Chromosome 3 (position 36467859)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGTCAGCACCTTTGCAGGTTATCCTGGCTCTATACTTTCTGTGGCAG[G/A]TATGTAAAGAGATTTTGAATTGTATAAACTGTGTGTTTGTTTCATTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6039
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083659 Nonsense 679 1529 16 34
Genomic Location:
Chromosome 3 (position 36464405)
KASP Assay ID:
554-3872.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAAGTATCCCTGAGGGGGCGCTGGTTGCTGTGGTGGGGCATGTGGGTT[C/A]GGGGAAGTCCTCTCTGCTTTCAGCTTTGCTGGGAGAGATGCATAAGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2103
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083659 Essential Splice Site 903 1529 21 34
Genomic Location:
Chromosome 3 (position 36457413)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAATATTTTGTATGAGTTTCAAACGATATGGTCACCTCACCAGCCTAA[T/G]AAAAACAAAAATGTTTTTCAATGTTTAAAAATCTTTAGTTGTTATATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083659 Nonsense 943 1529 23 34
Genomic Location:
Chromosome 3 (position 36455481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTAATGATGATGCTGCTGCAACAAAGACCAAATCTGCAGAAGCTTCC[C/T]GACTGACCGAAGCAGACAAGGCCAACACTGGCAGAGTATGAGCCAACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083659 Nonsense 1056 1529 25 34
Genomic Location:
Chromosome 3 (position 36454206)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAGCCTCCCGCTACCTGCACCAGACAATGCTCTATAACGTCCTGAGAT[C/G]ACCCATGTCTTTCTTTGAACGCACACCCAGCGGCAACCTGGTCAACCGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link