si:ch211-196f15.1

Ensembl ID:
ENSDARG00000059858
ZFIN ID:
ZDB-GENE-060526-71
Description:
Novel protein similar to vertebrate pregnancy-associated plasma protein A, pappalysin 1 (PAPPA) [Sou
Human Orthologue:
PAPPA
Human Description:
pregnancy-associated plasma protein A, pappalysin 1 [Source:HGNC Symbol;Acc:8602]
Mouse Orthologue:
Pappa
Mouse Description:
pregnancy-associated plasma protein A Gene [Source:MGI Symbol;Acc:MGI:97479]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44625 Nonsense Mutation detected in F1 DNA During 2017
sa20570 Essential Splice Site Available for shipment Available now
sa20569 Nonsense Available for shipment Available now
sa12988 Nonsense Available for shipment Available now
sa13003 Nonsense Available for shipment Available now
sa33750 Nonsense Available for shipment Available now
sa9050 Essential Splice Site Mutation detected in F1 DNA During 2017
sa25317 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44625
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Nonsense 29 1624 1 22
ENSDART00000133766   None 200 None 5
ENSDART00000135014 Nonsense 29 1606 1 22
Genomic Location (Zv9):
Chromosome 5 (position 67371973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTTTGCTTTTTCTCGTGTGCTTGGGATCAGAGTGTGGGACTCCACGG[C/T]GAATTGTAAGGTCTAAAAGAGACTTGGTACGCATCAGGGAAGCCAGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Essential Splice Site 127 1624 1 22
ENSDART00000133766   None 200 None 5
ENSDART00000135014   None 1606 None 22
Genomic Location (Zv9):
Chromosome 5 (position 67371675)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63422282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTGGATAAAACCCGAGGGTGGGCAACGCTCTCCAGCTGTTATCGGAG[G/A]TTTGGTTTGCTTAATTATGACTTGCATTATTATGTTCACCGCAGAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Nonsense 831 1624 7 22
ENSDART00000133766   None 200 None 5
ENSDART00000135014 Nonsense 821 1606 7 22
Genomic Location (Zv9):
Chromosome 5 (position 67308631)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63359238
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTAACAACGTCTCGCTGGGCCCTCAGTACGTGTTCTGTGACACGCTGT[T/A]AACGCTGAAGCTGGATGTGAAAGAGGAGGTGTACGGCGTGCAGTTCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Nonsense 948 1624 9 22
ENSDART00000133766   None 200 None 5
ENSDART00000135014 Nonsense 938 1606 9 22
ENSDART00000083684 Nonsense 948 1624 9 22
ENSDART00000133766   None 200 None 5
ENSDART00000135014 Nonsense 938 1606 9 22
Genomic Location (Zv9):
Chromosome 5 (position 67284523)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63335130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATGTAACTCTTTTAATGACTTGTTGAAATGTGCATTGCTTTCAGAYA[T/A]CTTGGAGAGGAATGTGAKGACATGAACTTTGCTAATGGAGATGGCTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Nonsense 948 1624 9 22
ENSDART00000133766   None 200 None 5
ENSDART00000135014 Nonsense 938 1606 9 22
ENSDART00000083684 Nonsense 948 1624 9 22
ENSDART00000133766   None 200 None 5
ENSDART00000135014 Nonsense 938 1606 9 22
Genomic Location (Zv9):
Chromosome 5 (position 67284523)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63335130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATGTAACTCTTTTAATGACTTGTTGAAATGTGCATTGCTTTCAGAYA[T/A]CTTGGAGAGGAATGTGAKGACATGAACTTTGCTAATGGAGATGGCTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Nonsense 1030 1624 10 22
ENSDART00000133766   None 200 None 5
ENSDART00000135014 Nonsense 1020 1606 10 22
Genomic Location (Zv9):
Chromosome 5 (position 67273615)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63324222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCAGTGGGCCACAGCAGTGGAGGTGTCCAATGAGGAGGCCATTCACTG[T/A]CCAGCTGAAGTCGCTGCTGGATATCCTGCCGTCACAAAGGTAAGATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Essential Splice Site 1043 1624 10 22
ENSDART00000133766   None 200 None 5
ENSDART00000135014 Essential Splice Site 1033 1606 10 22
Genomic Location (Zv9):
Chromosome 5 (position 67273575)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63324182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCATTCACTGTCCAGCTGAAGTCGCTGCTGGATATCCTGCYGTCACAAAG[G/A]TAAGATCATGGCTTAAAGTTTTAAARTTCTTTCCTGTGAGGGTTGAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Nonsense 1319 1624 16 22
ENSDART00000133766   None 200 None 5
ENSDART00000135014 Nonsense 1309 1606 16 22
Genomic Location (Zv9):
Chromosome 5 (position 67228620)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63279227
KASP Assay ID:
554-7539.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTATGTTTGTCCTTTTGTCTCCACAGGCAGTAATAACGTGCTGACGTG[T/A]ATGGAGGATGGCATGTGGTCCTTCCCCGAGGCTCTGTGTGAGCTGCGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification of ten loci associated with height highlights new biological pathways in human growth. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link