si:dkey-165i4.3

Ensembl ID:
ENSDARG00000059846
ZFIN ID:
ZDB-GENE-070705-307
Description:
UPF0493 protein KIAA1632 homolog [Source:UniProtKB/Swiss-Prot;Acc:A5WUT8]
Human Orthologue:
KIAA1632
Human Description:
KIAA1632 [Source:HGNC Symbol;Acc:29331]
Mouse Orthologue:
5430411K18Rik
Mouse Description:
RIKEN cDNA 5430411K18 gene Gene [Source:MGI Symbol;Acc:MGI:1918673]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33676 Nonsense Mutation detected in F1 DNA During 2017
sa14095 Essential Splice Site Available for shipment Available now
sa17986 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083644 Nonsense 1791 2341 36 44
ENSDART00000144525 Nonsense 1983 2532 35 43
Genomic Location (Zv9):
Chromosome 5 (position 43213576)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40994841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTATTTTTGGTGCAGATCGCTTGTTGCCAGGACAGAGAGGAGCTCTGT[G/A]GCTTCATCTCATGTTTTACTGTGAGACCTGCACTTCTCCTAAAATGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14095
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083644 Essential Splice Site 2243 2341 43 44
ENSDART00000144525 Essential Splice Site 2434 2532 42 43
Genomic Location (Zv9):
Chromosome 5 (position 43203531)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40984796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAATTRTGTGAAAAGTGTGCCTCACATCCTCTGCTCTTCCGTTGTTTG[A/G]GGTTTCGGGTTGTGGCGCGCAGCATGTCAGCCTTTCTGCTGGTTCAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083644 Nonsense 2258 2341 43 44
ENSDART00000144525 Nonsense 2449 2532 42 43
Genomic Location (Zv9):
Chromosome 5 (position 43203486)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40984751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGRGGTTTCGGGTTGTGGCGCGCAGCATGTCAGCCTTTCTGCTGGTT[C/T]AGGTGCCCTCAGAGAATCAGCTGCGTCTTCATCCCGGGACAGAGCTGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link